Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00034535
Source Database: WormBase (WB)
Availability: available
Source References: PMID:28394337
Synonyms: hrtIs3; hrtEx54.
Alternate IDs: WB-STRAIN:STR200, CGC_STR200
Notes: hrtIs3 [des-2p::myr::GFP + unc-122p::DsRed]. hrtEx54 [des-2p::mKate::SpvB + unc-119(+) + lin-48p::tdTomato]. Pick animals with tdTomato expression in the tail to maintain. Myristylated GFP marker for PVD. PVD development is severely affected by low levels of actin-perturbing DeAct-SpvB expression in PVD and FLP. Phenotype is more severe than that of DeAct-GS1 expressing strains STR198 and STR199. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.
Proper citation: RRID:WB-STRAIN:WBStrain00034535 Copy
http://www.wormbase.org/db/get?name=WBStrain00034537
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30254025
Synonyms: unc-119(ed3);hrtEx58[Pida-1::gfp::rab-8; Pgcy-36::mKate2]
Alternate IDs: WB-STRAIN:STR211
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00034537 Copy
http://www.wormbase.org/db/get?name=WBStrain00034539
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30254025
Synonyms: unc-116(e2310);hrtSi5[Pdes-2::ebp-2::gfp]
Alternate IDs: WB-STRAIN:STR221
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00034539 Copy
http://www.wormbase.org/db/get?name=WBStrain00034531
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30254025
Synonyms: unc-116(rh24sb79);hrtSi19[Pgcy-36::mKate2::rab-3];hrtEx33[Pgcy-36::BFP;ccRFP]
Alternate IDs: WB-STRAIN:STR172
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00034531 Copy
http://www.wormbase.org/db/get?name=WBStrain00034532
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30254025, PMID:38548742
Synonyms: hrtSi19[Pgcy-36::mKate2::rab-3];hrtEx33[Pgcy-36::BFP;ccRFP]
Alternate IDs: WB-STRAIN:STR173
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00034532 Copy
http://www.wormbase.org/db/get?name=WBStrain00034533
Source Database: WormBase (WB)
Availability: available
Source References: PMID:28394337
Synonyms: hrtIs3; hrtEx52.
Alternate IDs: WB-STRAIN:STR198, CGC_STR198
Notes: hrtIs3 [des-2p::myr::GFP + unc-122p::DsRed]. hrtEx52 [des-2p::mKate::GS1(high) + unc-119(+) + myo-2p::tdTomato]. Pick tdTomato+ animals to maintain. Myristylated GFP marker for PVD. PVD development is quite strongly affected by high levels of actin-perturbing DeAct-GS1 expression in PVD and FLP. Phenotype is more severe than that of the low DeAct-GS1 expressing strain STR199, but weaker than that of the DeAct-SpvB expressing strain STR200. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.
Proper citation: RRID:WB-STRAIN:WBStrain00034533 Copy
http://www.wormbase.org/db/get?name=WBStrain00034534
Source Database: WormBase (WB)
Availability: available
Source References: PMID:28394337
Synonyms: wdIs51; hrtEx53.
Alternate IDs: WB-STRAIN:STR199, CGC_STR199
Notes: wdIs51 [F49H12.4::GFP + unc-119(+)]; likely integrated in X. hrtEx53 [des-2p::mKate::GS1(low) + unc-119(+) + myo-2p::tdTomato]. Pick tdTomato+ animals to maintain. PVD development is somewhat affected by moderate levels of actin-perturbing DeAct-GS1 expression in PVD and FLP. Phenotype is less severe than that of the high DeAct-GS1 expressing strain STR198 and DeAct-SpvB expressing strain STR200. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.
Proper citation: RRID:WB-STRAIN:WBStrain00034534 Copy
http://www.wormbase.org/db/get?name=WBStrain00034540
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:26906482
Synonyms: unc-119(ed3); hrtEx66[Pwrt-2::mKate2::ePDZ; Pwrt-2::PH::gfp::LOVpep + cb-unc-119(+)]
Alternate IDs: WB-STRAIN:STR222
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00034540 Copy
http://www.wormbase.org/db/get?name=WBStrain00034545
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:26906482
Synonyms: unc-119(ed3); hrtSi24[Pgcy-36::tomm-20(aa1-41)::mKate2::LOVpep]; hrtEx78[Pgcy-36::unc-116 (aa1-381)::gfp::ePDZ; Pmyo-2::TdTomato]
Alternate IDs: WB-STRAIN:STR254
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00034545 Copy
http://www.wormbase.org/db/get?name=WBStrain00034634
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: mjIs11 III; mjIs17 IV.
Alternate IDs: WB-STRAIN:SX333, CGC_SX333
Notes: Made_by: Nicholas Lehrbach|"mjIs11 contains [myo-2::let-7 + unc-119(+)]. mjIs17contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)]."
Proper citation: RRID:WB-STRAIN:WBStrain00034634 Copy
http://www.wormbase.org/db/get?name=WBStrain00034635
Source Database: WormBase (WB)
Affected Genes: WBGene00003504(mut-7)|WBGene00004010(pha-1)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00003504(mut-7), WBGene00004010(pha-1), WBGene00006768(unc-32)
Availability: available
Source References: EMPTY
Synonyms: unc-32(e189) mut-7(pk204) pha-1(e2123) III; ccEx7271.
Alternate IDs: WB-STRAIN:SX340, CGC_SX340
Notes: ccEx7271 [let-858::GFP + pha-1(+)]. This strain expresses nuclear-localized GFP in all somatic nuclei, but reduced or no GFP in germ cells. If maintained at 20C, pha-1(ts) genotype will select for transgenic animals. Germ cell expression can be observed when maintained at 25C. Germline transgene silencing is abnormal.
Proper citation: RRID:WB-STRAIN:WBStrain00034635 Copy
http://www.wormbase.org/db/get?name=WBStrain00034630
Source Database: WormBase (WB)
Affected Genes: WBGene00004178(prg-1)|WBGene00004179(prg-2)|WBGene00006759(unc-22)
Genomic Alteration: WBGene00004178(prg-1), WBGene00004179(prg-2), WBGene00006759(unc-22)
Availability: available
Source References: EMPTY
Synonyms: prg-1(n4357) I; prg-2(n4358) unc-22(st136) IV.
Alternate IDs: WB-STRAIN:SX166, CGC_SX166
Notes: Mutagen:EMS(n4357 & n4358) Curator_confirmed WBPerson1983|"Transposon silencing normal."
Proper citation: RRID:WB-STRAIN:WBStrain00034630 Copy
http://www.wormbase.org/db/get?name=WBStrain00034631
Source Database: WormBase (WB)
Affected Genes: WBGene00004178(prg-1)|WBGene00006759(unc-22)
Genomic Alteration: WBGene00004178(prg-1), WBGene00006759(unc-22)
Availability: available
Source References: EMPTY
Synonyms: prg-1(n4357) I; unc-22(r765) IV.
Alternate IDs: WB-STRAIN:SX178, CGC_SX178
Notes: Mutagen:EMS/Tc4|"Twitching due to transposon insertion in unc-22."
Proper citation: RRID:WB-STRAIN:WBStrain00034631 Copy
http://www.wormbase.org/db/get?name=WBStrain00034633
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: mjIs17 IV.
Alternate IDs: WB-STRAIN:SX328, CGC_SX328
Notes: Made_by: Nicholas Lehrbach|"mjIs17 contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)]."|"mjIs17contains [myo-2::GFP::lin-41 + myo-2::mCherry:unc-54 (let-7 sensor)]."
Proper citation: RRID:WB-STRAIN:WBStrain00034633 Copy
http://www.wormbase.org/db/get?name=WBStrain00034646
Source Database: WormBase (WB)
Affected Genes: WBGene00008995(prde-1)
Genomic Alteration: WBGene00008995(prde-1)
Availability: available
Source References: EMPTY
Synonyms: prde-1(mj207) V.
Alternate IDs: WB-STRAIN:SX2499, CGC_SX2499
Notes: piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.
Proper citation: RRID:WB-STRAIN:WBStrain00034646 Copy
http://www.wormbase.org/db/get?name=WBStrain00034642
Source Database: WormBase (WB)
Affected Genes: WBGene00004178(prg-1)
Genomic Alteration: WBGene00004178(prg-1)
Availability: available
Source References: PMID:31402283, PMID:33086057
Synonyms: prg-1(n4357) I.
Alternate IDs: WB-STRAIN:SX922, CGC_SX922
Notes: 21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: GTTTTCTTTCCTTGGAGAGGT|"no longer available from the CGC."
Proper citation: RRID:WB-STRAIN:WBStrain00034642 Copy
http://www.wormbase.org/db/get?name=WBStrain00034612
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; heIs105 IV.
Alternate IDs: WB-STRAIN:SV1361, CGC_SV1361
Notes: heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. Strain is viable at 15-25 C. heIs105 carries a read-out construct which allows the visualization of the CRE lox mediated recombination by a switch from red to green. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
Proper citation: RRID:WB-STRAIN:WBStrain00034612 Copy
http://www.wormbase.org/db/get?name=WBStrain00034613
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; heSi141 X.
Alternate IDs: WB-STRAIN:SV1438, CGC_SV1438
Notes: heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Strain is viable at 15-25 C, but non-tissue specific recombination is observed more frequently in other tissues at higher temperatures (25C). Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
Proper citation: RRID:WB-STRAIN:WBStrain00034613 Copy
http://www.wormbase.org/db/get?name=WBStrain00034614
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; heSi142 X.
Alternate IDs: WB-STRAIN:SV1439, CGC_SV1439
Notes: heSi142 [elt-2::FLAG::CRE::tbb-2 + unc-119(+)] X. Expression of CRE recombinase in the intestine driven by the elt-2 promoter. Strain is viable at 15-25 C, but non-tissue specific recombination is observed more frequently in other tissues at higher temperatures (25C). Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
Proper citation: RRID:WB-STRAIN:WBStrain00034614 Copy
http://www.wormbase.org/db/get?name=WBStrain00034617
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; heIs145 IV
Alternate IDs: WB-STRAIN:SV1450, CGC_SV1450
Notes: heIs145 [rps-27::loxP::NLS::mCherry::let858 UTR::eft-3::tagBFP::tbb-2 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. Maintain at 15-25C. heIs145 expresses a read-out construct used to visualize CRE activity and specificity, and to test whether CRE expression is likely to induce loss of a gene of interest (tagBFP in this case) in a given tissue. Expression of CRE will result in a change from mCherry to GFP and loss of tagBFP expression in those cells where CRE is active. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
Proper citation: RRID:WB-STRAIN:WBStrain00034617 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within Kravitz that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.