Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
ahcy-1(syb646[ahcy-1::GFP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063357 | Caenorhabditis elegans | ahcy-1(syb646[ahcy-1::GFP]) I. | GFP tag inserted at C-terminus of endogenous ahcy-1 locus. Derived by out-crossing parental strain PHX646 two times to N2. Reference: Thapa P, et al. NPJ Aging. 2023 Dec 5;9(1):27. doi: 10.1038/s41514-023-00125-1. PMID: 38052822.|"Made_by: SunyBiotech" | WBGene00019322(ahcy-1) | WBGene00019322(ahcy-1) | WB-STRAIN:WBStrain00063357 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:53 | 0 | ||||
|
ahcy-1(syb784 *syb646[ahcy-1(Y145C)::GFP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063358 | Caenorhabditis elegans | ahcy-1(syb784 *syb646[ahcy-1(Y145C)::GFP]) I. | Engineered Y145C substitution mutation in endogenously GFP-tagged ahcy-1 locus. ahcy-1(Y145C) mutation mimics the pathogenic human mutation AHCY Y143C. ahcy-1(Y145C) mutants have a prolonged lifespan and are larger than control animals. ahcy-1(Y145C) mutants are fertile and produce a brood of laid and hatched eggs similar to control animals. ahcy-1(Y145C) mutants show a slight increase in SAH and a decrease in SAM levels, leading to an increased SAH to SAM ratio. See WOP122 for control strain. Derived by out-crossing parental strain PHX784 two times to N2. Reference: Thapa P, et al. NPJ Aging. 2023 Dec 5;9(1):27. doi: 10.1038/s41514-023-00125-1. PMID: 38052822.|"Made_by: SunyBiotech" | WBGene00019322(ahcy-1) | WBGene00019322(ahcy-1) | WB-STRAIN:WBStrain00063358 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:53 | 0 | ||||
|
attf-6(how51[GFP::TEV::AID::attf-6]) I; wrdSi51 II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063355 | Caenorhabditis elegans | attf-6(how51[GFP::TEV::AID::attf-6]) I; wrdSi51 II. | Made_by: Yi-hui Wang|"wrdSi51 [mex-5p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). GFP::TEV::AID tag inserted at the N-terminus of the endogenous attf-6 locus facilitates auxin-inducible degradation of GFP::TEV::AID::ATTF-6. Reference: Wang Y, et al. Nucleic Acids Research. 2025 Feb 28; 53(4): gkaf079. doi: 10.1093/nar/gkaf079 PMID: 39945323." | WBGene00012474(attf-6) | WBGene00012474(attf-6) | WB-STRAIN:WBStrain00063355 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:53 | 0 | ||||
|
WHY546 attf-6(how52[attf-6::3xflag]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063356 | Caenorhabditis elegans | WHY546 attf-6(how52[attf-6::3xflag]) I. | 3xFlag tag inserted at the C-terminus of the endogenous attf-6 locus. Reference: Wang Y, et al. Nucleic Acids Research. 2025 Feb 28; 53(4): gkaf079. doi: 10.1093/nar/gkaf079 PMID: 39945323.|"Made_by: Yi-Hui Wang" | WBGene00012474(attf-6) | WBGene00012474(attf-6) | WB-STRAIN:WBStrain00063356 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:53 | 0 | ||||
|
MAD Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00043989 | Caenorhabditis elegans | EMPTY | Generated based on CalTech XREF data | WB-STRAIN:WBStrain00043989 | WormBase (WB) | WB | unknown | PMID:38719808 PMID:38878153 |
2026-09-05 04:59:54 | 0 | |||||
|
IS7 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00043477 | Caenorhabditis elegans | EMPTY | Generated based on CalTech XREF data | WB-STRAIN:WBStrain00043477 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:54 | 0 | ||||||
|
WN1 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00046622 | Caenorhabditis elegans | EMPTY | Generated based on WC-CalTech XREF data | WB-STRAIN:WBStrain00046622 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:54 | 0 | ||||||
|
+/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ lmbr-1(hd7180 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063342 | Caenorhabditis elegans | +/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ lmbr-1(hd7180 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) III. | Made_by: VH KO group|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7180 and CGC66. hd7180 is a 1876 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCTTTTTACAGATTTAATAACACCAAAT; Right flanking sequence: TGGCTACAAATACCTTGAAATTGTTATTCG. sgRNA #1: GGCCCAATACGCCCTGGAGG; sgRNA #2: GACATGCTCTCTAATCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00019877(lmbr-1) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00019877(lmbr-1) | WB-STRAIN:WBStrain00063342 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:53 | 0 | ||||
|
+/nT1 [umnls49] IV; algn-5 (hd7175[loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063340 | Caenorhabditis elegans | +/nT1 [umnls49] IV; algn-5 (hd7175[loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/nT1 V. | Made_by: VH KO group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7175 and CGC63. hd7175 is a 1325 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCCAAAAAATCAATATCTTCACCATTTTCA; Right flanking sequence: TGGAGCTACAAAATTCGCCGATTTTGAAAA. sgRNA #1: GACTTTCCTACGCAACACCA; sgRNA #2: ATTCTCTTCGCAGATGCCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00019276(algn-5) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00019276(algn-5) | WB-STRAIN:WBStrain00063340 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:53 | 0 | ||||
|
hpo-11 (hd7177 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) /hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063341 | Caenorhabditis elegans | hpo-11 (hd7177 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) /hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. | Made_by: VH KO group|"umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7177 and CGC92. hd7177 is a 7087 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GATGGTCCATTTGTATTAGTTGTTGTACCA; Right flanking sequence: TTTTAGTTGGAACGGCTCGCGCCCAAGCAG. sgRNA #1: CTTGGCTGTGATGATTGACC; sgRNA #2: AAACGGAACAAGGACACGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00000254(bli-4)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00010427(hpo-11) | WBGene00000254(bli-4), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00010427(hpo-11) | WB-STRAIN:WBStrain00063341 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:53 | 0 | ||||
|
epg-5(tm3425) II; vkIs3785 X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063347 | Caenorhabditis elegans | epg-5(tm3425) II; vkIs3785 X. | Made_by: Zachary D. Dawson|"vkIs3785 [nhx-2p::gfp::lgg-1::mKate2]; inserted into LG X. Fluorescent reporter for autophagic flux. GFP aggregation in intestine. Reference: Dawson ZD, et al. Autophagy rep. 2024;3(1):2371736. doi: 10.1080/27694127.2024.2371736. PMID: 39070663." | WBGene00016968(epg-5) | WBGene00016968(epg-5) | WB-STRAIN:WBStrain00063347 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:53 | 0 | ||||
|
atg-3(bp412) IV; vkIs3785 X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063348 | Caenorhabditis elegans | atg-3(bp412) IV; vkIs3785 X. | Made_by: Zachary D. Dawson|"vkIs3785 [nhx-2p::gfp::lgg-1::mKate2]; inserted into LG X. Fluorescent reporter for autophagic flux. Stronger GFP expression in intestine than in wild-type background. Reference: Dawson ZD, et al. Autophagy rep. 2024;3(1):2371736. doi: 10.1080/27694127.2024.2371736. PMID: 39070663." | WBGene00021922(atg-3) | WBGene00021922(atg-3) | WB-STRAIN:WBStrain00063348 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:53 | 0 | ||||
|
QX2 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00045019 | Caenorhabditis elegans | EMPTY | Generated based on WC-CalTech XREF data | WB-STRAIN:WBStrain00045019 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:54 | 0 | ||||||
|
wbmIs79 *wbmIs67 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063349 | Caenorhabditis elegans | wbmIs79 *wbmIs67 V. | wbmIs79 [eft-3p::3XFLAG::raga-1::SL2::wrmScarlet::unc-54 3'UTR] *wbmIs67. Somatic-specific RAGA-1 and wrmScarlet expression driven by the eft-3p promoter. Derived by CRISPR-mediated insertion of raga-1 downstream of tissue-specific eft-3 promoter of wbmIs67 insertion in parental strain WBM1143. wbmIs67 [eft-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs65] (V:8645000). Reference: Zhang Y, et al. Elife. 2019 Aug 14;8:e49158. doi: 10.7554/eLife.49158. PMID: 31411562. | WB-STRAIN:WBStrain00063349 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:53 | 0 | ||||||
|
UL7 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00046349 | Caenorhabditis elegans | EMPTY | Generated based on CalTech XREF data | WB-STRAIN:WBStrain00046349 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:54 | 0 | ||||||
|
PT4 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00044818 | Caenorhabditis elegans | EMPTY | Generated based on CalTech XREF data | WB-STRAIN:WBStrain00044818 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:54 | 0 | ||||||
|
WN9 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00046681 | Caenorhabditis elegans | EMPTY | Generated based on WC-CalTech XREF data | WB-STRAIN:WBStrain00046681 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:54 | 0 | ||||||
|
QX4 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00045074 | Caenorhabditis elegans | EMPTY | Generated based on WC-CalTech XREF data | WB-STRAIN:WBStrain00045074 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:54 | 0 | ||||||
|
QX3 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00045065 | Caenorhabditis elegans | EMPTY | Generated based on WC-CalTech XREF data | WB-STRAIN:WBStrain00045065 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:54 | 0 | ||||||
|
C09B9.85(hd7184[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063339 | Caenorhabditis elegans | C09B9.85(hd7184[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 3777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCTGTGCAGATCCAACTAGGGCGTCTCCA; Right flanking sequence: AGGAAATTTTTGTCGAAAATTCTGAAAAAT. sgRNA #1: CATGGTATGGATGGAAGCAT; sgRNA #2: CAAAGTTAGCAATTTTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063339 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:53 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
