Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
lem-2(sbw5[lem-2::mNeonGreen]) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063130 Caenorhabditis elegans lem-2(sbw5[lem-2::mNeonGreen]) II. Made_by: Sarah Barger|"mNeonGreen tag inserted at C-terminus of endogenous lem-2 locus using self-exising drug selection casette method (described by Hastie et al., 2019 J Microbiol Biol Educ). Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https:" WBGene00002275(lem-2) WBGene00002275(lem-2) WB-STRAIN:WBStrain00063130 WormBase (WB) WB unknown 2026-09-05 04:59:50 0
dpy-10(cn64) rab-3(ftw79) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063094 Caenorhabditis elegans dpy-10(cn64) rab-3(ftw79) II. rab-3(ftw79[rab-3::SL2::LoxP::GFP::NLS::3'UTR::Abeta(inv)::sigPep(inv)::T2A(inv)::wrmScarlet11(inv)::LoxP(inv)]) II. Modified endogenous rab-3 locus co-expresses stochastic, switchable cassette by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. Inverted LoxP sites flank the GFP-NLS and inverted wrmScarlet11::T2A::signalPeptide::Abeta insert. Please contact Ryan Littlefield prior to publishing work using this strain. WBGene00001072(dpy-10)|WBGene00004267(rab-3) WBGene00001072(dpy-10), WBGene00004267(rab-3) WB-STRAIN:WBStrain00063094 WormBase (WB) WB unknown 2026-09-05 04:59:49 0
mlc-2(ftw80[LifeAct::wrmScarlet::SL2::mlc-2]) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063095 Caenorhabditis elegans mlc-2(ftw80[LifeAct::wrmScarlet::SL2::mlc-2]) X. Endogenous mlc-2 locus co-expresses LifeAct peptide fused to wrmScarlet. Myosin light chain is untagged. Bright red fluorescence in all muscles is visible by dissection fluorescence microscopy. Broad bands of fluorescence are visible in body wall muscle by confocal microscopy. Please contact Ryan Littlefield prior to publishing work with this strain. WBGene00003370(mlc-2) WBGene00003370(mlc-2) WB-STRAIN:WBStrain00063095 WormBase (WB) WB unknown 2026-09-05 04:59:49 0
lem-2(sbw20) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063133 Caenorhabditis elegans lem-2(sbw20) II. CRISPR/Cas9-engineered deletion of entire lem-2 locus. Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https:|"Made_by: Sarah Barger" WBGene00002275(lem-2) WBGene00002275(lem-2) WB-STRAIN:WBStrain00063133 WormBase (WB) WB unknown 2026-09-05 04:59:50 0
ustSi268 I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063134 Caenorhabditis elegans ustSi268 I. ustSi268 [mex-5p::tagrfp::elli-1::tbb-2 3'UTR] I. Inserted into LG I (-5.51 cM) locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544. WB-STRAIN:WBStrain00063134 WormBase (WB) WB unknown 2026-09-05 04:59:50 0
baf-1(sbw7[mNeonGreen::baf-1]) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063131 Caenorhabditis elegans baf-1(sbw7[mNeonGreen::baf-1]) III. Made_by: Sarah Barger|"mNeonGreen tag inserted at N-terminus of endogenous baf-1 locus using self-excising drug selection cassette method (described by Dickinson, et al. 2015, Genetics). Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https:" WBGene00000235(baf-1) WBGene00000235(baf-1) WB-STRAIN:WBStrain00063131 WormBase (WB) WB unknown 2026-09-05 04:59:50 0
tni-3(ftw13[tni-3::mCherry::SL2::GFP::NLS]) V.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063099 Caenorhabditis elegans tni-3(ftw13[tni-3::mCherry::SL2::GFP::NLS]) V. Endogenous tni-3 locus tagged with mCherry using CRISPR/Cas9. GFP-nls coexpressed from the endogenous promoter using SL2 trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.|"Made_by: Ryan Littlefield & Tammie Ward" WBGene00006585(tni-3) WBGene00006585(tni-3) WB-STRAIN:WBStrain00063099 WormBase (WB) WB unknown 2026-09-05 04:59:50 0
fbf-2(ust337[fbf-2::GFP::3xFlag]) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063138 Caenorhabditis elegans fbf-2(ust337[fbf-2::GFP::3xFlag]) II. GFP::3xFlag inserted into endogenous fbf-2 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang" WBGene00001402(fbf-2) WBGene00001402(fbf-2) WB-STRAIN:WBStrain00063138 WormBase (WB) WB unknown 2026-09-05 04:59:50 0
ZK1240.6(ve999[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063086 Caenorhabditis elegans ZK1240.6(ve999[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 398 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCCTGAAAATTAATATTAGGTACCTGACCT ; Right flanking sequence: ACTTGGAAATTGGAGAGCAAGTAAAAGTTA. ZK1240.6 sgRNA A: ACTTCAGAACCTGATATGCA; ZK1240.6 sgRNA B: TAGTCGAGTTATTCGTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00063086 WormBase (WB) WB unknown 2026-09-05 04:59:49 0
Y25C1A.8(ve996[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063083 Caenorhabditis elegans Y25C1A.8(ve996[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 3675 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CACTTTCTGGGCAAGAGCATTCACCGCCCG ; Right flanking sequence: CGGTTTCGCTGAAAATCGATAATTTTTGGG. Y25C1A.8 sgRNA A: CAGATGCTCATGCTCATGCT; Y25C1A.8 sgRNA B: CCAATTTTGCTTTTCGCGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00063083 WormBase (WB) WB unknown 2026-09-05 04:59:49 0
tbb-4(tj74[gfp::TEV::3xFLAG::tbb-4]) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063122 Caenorhabditis elegans tbb-4(tj74[gfp::TEV::3xFLAG::tbb-4]) X. GFP::TEV::3xFLAG tag inserted into the endogenous tbb-4 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119. WBGene00006538(tbb-4) WBGene00006538(tbb-4) WB-STRAIN:WBStrain00063122 WormBase (WB) WB unknown 2026-09-05 04:59:50 0
mec-7(tj77[gfp::TEV::3xFLAG::mec-7]) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063123 Caenorhabditis elegans mec-7(tj77[gfp::TEV::3xFLAG::mec-7]) X. GFP::TEV::3xFLAG tag inserted into the endogenous mec-7 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119. WBGene00003171(mec-7) WBGene00003171(mec-7) WB-STRAIN:WBStrain00063123 WormBase (WB) WB unknown 2026-09-05 04:59:50 0
tba-7(tj66[gfp::TEV::3xFLAG::tba-7]) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063120 Caenorhabditis elegans tba-7(tj66[gfp::TEV::3xFLAG::tba-7]) III. GFP::TEV::3xFLAG tag inserted into the endogenous tba-7 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.|"Made_by: Hiroyuki Obinata" WBGene00006533(tba-7) WBGene00006533(tba-7) WB-STRAIN:WBStrain00063120 WormBase (WB) WB unknown 2026-09-05 04:59:50 0
tba-5(tj102[gfp::TEV::3xFLAG::tba-5]) I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063126 Caenorhabditis elegans tba-5(tj102[gfp::TEV::3xFLAG::tba-5]) I. GFP::TEV::3xFLAG tag inserted into the endogenous tba-5 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.|"Made_by: Shizuka Onodera" WBGene00006531(tba-5) WBGene00006531(tba-5) WB-STRAIN:WBStrain00063126 WormBase (WB) WB unknown 2026-09-05 04:59:50 0
tba-9(tj100[gfp::TEV::3xFLAG::tba-9]) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063125 Caenorhabditis elegans tba-9(tj100[gfp::TEV::3xFLAG::tba-9]) X. GFP::TEV::3xFLAG tag inserted into the endogenous tba-9 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.|"Made_by: Hiroyuki Obinata" WBGene00006535(tba-9) WBGene00006535(tba-9) WB-STRAIN:WBStrain00063125 WormBase (WB) WB unknown 2026-09-05 04:59:50 0
ustSi64 II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063195 Caenorhabditis elegans ustSi64 II. ustSi64 [wago-3p::3xFlag::GFP::wago-3::wago-3 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. WB-STRAIN:WBStrain00063195 WormBase (WB) WB unknown 2026-09-05 04:59:51 0
ife-3(ust639[ife-3::GFP::3xFlag]) V.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063199 Caenorhabditis elegans ife-3(ust639[ife-3::GFP::3xFlag]) V. GFP::3xFlag inserted into endogenous ife-3 locus using CRISPR/CAS9 engineering. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.|"Made_by: Chenmimg Zeng" WBGene00002061(ife-3) WBGene00002061(ife-3) WB-STRAIN:WBStrain00063199 WormBase (WB) WB unknown 2026-09-05 04:59:51 0
wyIs891 III; unc-10(wy1235[unc-10::FLPon::mScarlet-I]) syd-2(wy1323) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063237 Caenorhabditis elegans wyIs891 III; unc-10(wy1235[unc-10::FLPon::mScarlet-I]) syd-2(wy1323) X. Made_by: Nathan McDonald|"wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. GFP tag inserted into endogenous syd-2 locus with (517-836) region replaced by worm-optimized FUS 1-163. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945." WBGene00006364(syd-2)|WBGene00006750(unc-10) WBGene00006364(syd-2), WBGene00006750(unc-10) WB-STRAIN:WBStrain00063237 WormBase (WB) WB unknown 2026-09-05 04:59:51 0
wyIs891 III; unc-10(wy1235[unc-10::FLPon::mScarlet-I]) syd-2(wy5) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063234 Caenorhabditis elegans wyIs891 III; unc-10(wy1235[unc-10::FLPon::mScarlet-I]) syd-2(wy5) X. Made_by: Nathan McDonald|"wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945." WBGene00006364(syd-2)|WBGene00006750(unc-10) WBGene00006364(syd-2), WBGene00006750(unc-10) WB-STRAIN:WBStrain00063234 WormBase (WB) WB unknown 2026-09-05 04:59:51 0
rab-3(wy1332[mScarlet-I::FLPon::rab-3B]) II; wyIs891 III; syd-2(wy1052[GFP::syd-2]) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063235 Caenorhabditis elegans rab-3(wy1332[mScarlet-I::FLPon::rab-3B]) II; wyIs891 III; syd-2(wy1052[GFP::syd-2]) X. Made_by: Nathan McDonald|"wyIs891 [unc-86p::FLP + odr-1p::RFP] III. mScarlet-I::FLPon tag inserted into endogenous rab-3 locus specifically tagging isoform B, which is most abundant in neurons. GFP tag inserted into N-terminus of endogenous syd-2 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945." WBGene00004267(rab-3)|WBGene00006364(syd-2) WBGene00004267(rab-3), WBGene00006364(syd-2) WB-STRAIN:WBStrain00063235 WormBase (WB) WB unknown 2026-09-05 04:59:51 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Kravitz Dataset1 Resources

    Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.