Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688004
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5688004
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5688004 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6484574
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 6484574
Notes: This strain was produced by injecting ZFNs targeting the sequence CACCACATGCTCCTGccaggCAGGCTTCACTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 104-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_6484574 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6484579
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 6484579
Notes: This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5BN/Mcwi strain rat embryos. The resulting mutation is an 11-bp deletion in exon 2.
Proper citation: RRID:RGD_6484579 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6893440
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 6893440
Notes: This strain was produced by injecting ZFNs targeting the sequence TCCATCCCGAACTACAACaacttcCACGCAGCCGGGGGCCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 4.
Proper citation: RRID:RGD_6893440 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=60986
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 60986
Notes: Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. NIH Autoimmune Rat Model Repository and Development Center
Proper citation: RRID:RGD_60986 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=60987
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 60987
Notes: Milan Hypertensive Strain: Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure (Bianchi et al 1974, Barber et al, 1994).
Proper citation: RRID:RGD_60987 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=61011
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 61011
Notes: Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Sublines of diabetic-prone and diabetic-resistant animals have been developed, and there are also subline differences in the incidence, age of onset, untreated survival time of diabetes, leucopenia and body weight gain which can be attributed to genetic factors (Kloting et al 1987). A detailed study of 24 inbred and two outbred lines of diabetes-prone and diabetes resistant BB rats using eight marker loci found substantial genetic variation among and some variation within some of the colonies. The 22 colonies which were apparently isogenic could be divided into four groups on the basis of the marker loci (Prins et al 1990).
Proper citation: RRID:RGD_61011 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10026
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 10026
Notes: To N 1964 at F18+? from Maas. Developed by Broadhurst, 1954, from a commercial stock, with selection for low defecation response in an open field. A number of parallel sublines are in existence; these differ at least at the agouti and the major histocompatibility loci.
Proper citation: RRID:RGD_10026 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68058
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68058
Notes: Kunz and Gill from outbred NEDH rats supplied by the Animal Research Center, Harvard University (Kunz and Gill 1974, Kunz et al 1974).
Proper citation: RRID:RGD_68058 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68119
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68119
Notes: Reserved symbol for strain in development now at F6 (NIH 1989).
Proper citation: RRID:RGD_68119 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=728193
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: outbred
Availability: Extinct
Alternate IDs: RGD_728193, 728193, RRRC_239, RRRC_0239, RRRC_00239
Notes: To N 1945 from Sprague Dawley, Inc. Colony closed since then. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center
Proper citation: RRID:RRRC_00239 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=631283
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Extinct
Alternate IDs: 631283
Notes: This congenic substrain contains an F344 chromosome 10 segment transferred to a DA background.
Proper citation: RRID:RGD_631283 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139879
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 4139879
Notes: This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.
Proper citation: RRID:RGD_4139879 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5508371
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5508371
Notes: This strain was produced by injecting ZFNs targeting the sequence GCCCCAGCCATGCTGTGCtatgtGACGAGGCCGGACGCGGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 51-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_5508371 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5509997
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5509997
Notes: This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS.BN-(D13Rat20-D13Got22)/Mcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6.
Proper citation: RRID:RGD_5509997 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5687974
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5687974
Notes: This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5BN/Mcwi strain rat embryos. The resulting mutation is a 2-bp framesnift deletion in exon 2.
Proper citation: RRID:RGD_5687974 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5687992
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5687992
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5687992 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5687987
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5687987
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5687987 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688006
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5688006
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5688006 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688002
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5688002
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5688002 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within Kravitz that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.