Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 188 showing 3741 ~ 3760 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00027468

http://www.wormbase.org/db/get?name=WBStrain00027468

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)
Genomic Alteration: WBGene00001072(dpy-10)
Availability: available
Source References: EMPTY
Synonyms: nDf50 nDf49/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:MT14533, CGC_MT14533
Notes: Homozygous Emb deletion chromosome balanced by GFP and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nDf50 nDf49 homozygotes (arrest as late embryos). Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Curr Bio (2010) 20:367-73.|"Made_by: Ezequiel Alvarez-Saa"

Proper citation: RRID:WB-STRAIN:WBStrain00027468 Copy   


  • RRID:WB-STRAIN:WBStrain00027501

http://www.wormbase.org/db/get?name=WBStrain00027501

Source Database: WormBase (WB)
Affected Genes: WBGene00003274(mir-46)|WBGene00003275(mir-47)
Genomic Alteration: WBGene00003274(mir-46), WBGene00003275(mir-47)
Availability: available
Source References: EMPTY
Synonyms: mir-46(n4475) III; mir-47(gk167) X.
Alternate IDs: WB-STRAIN:MT14993, CGC_MT14993
Notes: Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00027501 Copy   


  • RRID:WB-STRAIN:WBStrain00027539

http://www.wormbase.org/db/get?name=WBStrain00027539

Source Database: WormBase (WB)
Affected Genes: WBGene00003338(mir-244)
Genomic Alteration: WBGene00003338(mir-244)
Availability: available
Source References: EMPTY
Synonyms: mir-244(n4367) I.
Alternate IDs: WB-STRAIN:MT16033, CGC_MT16033
Notes: Deletion breakpoints are: CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"

Proper citation: RRID:WB-STRAIN:WBStrain00027539 Copy   


  • RRID:WB-STRAIN:WBStrain00027531

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027531

Source Database: WormBase (WB)
Affected Genes: WBGene00002169(isw-1)
Genomic Alteration: WBGene00002169(isw-1)
Availability: available
Source References: PMID:31397537, PMID:38190406
Synonyms: isw-1(n3294) III.
Alternate IDs: WB-STRAIN:MT15795, CGC_MT15795
Notes: Wild type vulva; semi-sterile. Suppressor of lin-53(n833) and lin-15(n767).

Proper citation: RRID:WB-STRAIN:WBStrain00027531 Copy   


  • RRID:WB-STRAIN:WBStrain00027532

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027532

Source Database: WormBase (WB)
Affected Genes: WBGene00003334(mir-240)
Genomic Alteration: WBGene00003334(mir-240)
Availability: available
Source References: EMPTY
Synonyms: mir-240(n4541) X.
Alternate IDs: WB-STRAIN:MT15873, CGC_MT15873
Notes: Deletion breakpoints are:TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00027532 Copy   


  • RRID:WB-STRAIN:WBStrain00027533

http://www.wormbase.org/db/get?name=WBStrain00027533

Source Database: WormBase (WB)
Affected Genes: WBGene00000820(csp-2)
Genomic Alteration: WBGene00000820(csp-2)
Availability: available
Source References: EMPTY
Synonyms: csp-2(n4871) IV.
Alternate IDs: WB-STRAIN:MT15883, CGC_MT15883
Notes: n4871 is a 1136 bp deletion that removes the last five exons, including the putative protease active site. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.

Proper citation: RRID:WB-STRAIN:WBStrain00027533 Copy   


  • RRID:WB-STRAIN:WBStrain00027530

http://www.wormbase.org/db/get?name=WBStrain00027530

Source Database: WormBase (WB)
Affected Genes: WBGene00043991(mir-258.2)
Genomic Alteration: WBGene00043991(mir-258.2)
Availability: available
Source References: EMPTY
Synonyms: mir-258.2(n4797) X.
Alternate IDs: WB-STRAIN:MT15767, CGC_MT15767
Notes: Deletion breakpoints are:ATCAAAGTGAACAAATACG / TGCTCTTCTCCATAACCAAC...CGGCGAATTCCTTATGATTTG / GTCTCTCTTTTGTAGTATGAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:ATCAAAGTGAACAAATACG / TGCTCTTCTCCATAACCAAC...CGGCGAATTCCTTATGATTTG / GTCTCTCTTTTGTAGTATGAAT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00027530 Copy   


  • RRID:WB-STRAIN:WBStrain00027528

http://www.wormbase.org/db/get?name=WBStrain00027528

Source Database: WormBase (WB)
Affected Genes: WBGene00021661(mbtr-1)
Genomic Alteration: WBGene00021661(mbtr-1)
Availability: available
Source References: EMPTY
Synonyms: mbtr-1(n4775) I.
Alternate IDs: WB-STRAIN:MT15643, CGC_MT15643
Notes: WT phenotype. From Horvitz 2002 deletion library; deletion removes exons 4, 5, and 6 causing a frame shift after amino acid 165. This should remove last three MBT repeats. Y48G1A.6.

Proper citation: RRID:WB-STRAIN:WBStrain00027528 Copy   


  • RRID:WB-STRAIN:WBStrain00027529

http://www.wormbase.org/db/get?name=WBStrain00027529

Source Database: WormBase (WB)
Affected Genes: WBGene00000455(ceh-34)
Genomic Alteration: WBGene00000455(ceh-34)
Availability: available
Source References: EMPTY
Synonyms: nIs175 IV; ceh-34(4796) V.
Alternate IDs: WB-STRAIN:MT15695, CGC_MT15695
Notes: nIs175 [ceh-28p::4xNLS::GFP + lin-15(+)] IV. Extra GFP+ M4 observed in nIs175. Reference: Takashi H, et al. PNAS 2010 Aug 31;107(35):15479-84.

Proper citation: RRID:WB-STRAIN:WBStrain00027529 Copy   


  • RRID:WB-STRAIN:WBStrain00027524

http://www.wormbase.org/db/get?name=WBStrain00027524

Source Database: WormBase (WB)
Affected Genes: WBGene00003004(lin-15)|WBGene00003037(lin-54)|WBGene00006766(unc-30)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00003004(lin-15), WBGene00003037(lin-54), WBGene00006766(unc-30), WBGene00023498(lin-15A)
Availability: available
Source References: EMPTY
Synonyms: unc-30(e191) lin-54(n3423) IV/nT1 [qIs51] (IV;V); lin-15A(n767) X.
Alternate IDs: WB-STRAIN:MT15537, CGC_MT15537
Notes: Heterozygotes are Muv and GFP+ and segregate SteUncMuv GFP- and dead eggs. n3423 is PVul and sterile when alone; Muv in synMuv class A background.

Proper citation: RRID:WB-STRAIN:WBStrain00027524 Copy   


  • RRID:WB-STRAIN:WBStrain00027525

http://www.wormbase.org/db/get?name=WBStrain00027525

Source Database: WormBase (WB)
Affected Genes: WBGene00003286(mir-58.1)
Genomic Alteration: WBGene00003286(mir-58.1)
Availability: available
Source References: EMPTY
Synonyms: nDf53 III; mir-58.1(n4640) IV; nDf54 X.
Alternate IDs: WB-STRAIN:MT15563, CGC_MT15563
Notes: Made_by: Horvitz Lab|"Sick strain. mir-80 and mir-227 are deleted in nDf53. mir-81, mir-82, T02D1.2 are deleted in nDf54. Deletion breakpoints for n4640 are:CCGGCCAAATCTAGAACTGC / AAGAGTACGGTCTTG...GACTGAGCTAGAGTG / ACCTCTGATAATACGGAACGG. Deletion breakpoints for nDf53 are: ACTCATTTCGTTCGCCAGAAATTC / TCAGTTTGTGTA...ATAGCAGAGGT / ATTAGGAGAGTATAGACATCGAAAGCA. Deletion breakpoints for nDf54 are AAAATTTTTAAATTCTGAAATTAG / TTAAAAAACTGG...ATGAGTGGCAAA / AACTGATTGTGAGTAATTGTCATCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."

Proper citation: RRID:WB-STRAIN:WBStrain00027525 Copy   


  • RRID:WB-STRAIN:WBStrain00027522

http://www.wormbase.org/db/get?name=WBStrain00027522

Source Database: WormBase (WB)
Affected Genes: WBGene00003311(mir-83)
Genomic Alteration: WBGene00003311(mir-83)
Availability: available
Source References: EMPTY
Synonyms: mir-83(n4638) IV.
Alternate IDs: WB-STRAIN:MT15501, CGC_MT15501
Notes: Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00027522 Copy   


  • RRID:WB-STRAIN:WBStrain00027560

http://www.wormbase.org/db/get?name=WBStrain00027560

Source Database: WormBase (WB)
Affected Genes: WBGene00003348(mir-254)
Genomic Alteration: WBGene00003348(mir-254)
Availability: available
Source References: EMPTY
Synonyms: mir-254(n4470) X.
Alternate IDs: WB-STRAIN:MT16506, CGC_MT16506
Notes: Deletion breakpoints are: AAAATTTATTGAATTTTT / ATGAAGAATTACTATAAT...TCCAGGAGTGCAGTACGA / TCTCGAACCATGTTTTCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"

Proper citation: RRID:WB-STRAIN:WBStrain00027560 Copy   


  • RRID:WB-STRAIN:WBStrain00027563

http://www.wormbase.org/db/get?name=WBStrain00027563

Source Database: WormBase (WB)
Affected Genes: WBGene00003041(lin-61)|WBGene00013006(lin-38)
Genomic Alteration: WBGene00003041(lin-61), WBGene00013006(lin-38)
Availability: available
Source References: EMPTY
Synonyms: lin-61(n3447) I; lin-38(n751) II.
Alternate IDs: WB-STRAIN:MT16532, CGC_MT16532
Notes: Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.

Proper citation: RRID:WB-STRAIN:WBStrain00027563 Copy   


  • RRID:WB-STRAIN:WBStrain00027557

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027557

Source Database: WormBase (WB)
Affected Genes: WBGene00003288(mir-60)
Genomic Alteration: WBGene00003288(mir-60)
Availability: available
Source References: EMPTY
Synonyms: mir-60(n4947) II.
Alternate IDs: WB-STRAIN:MT16471, CGC_MT16471
Notes: Deletion breakpoints are:GAAACTTGTTCTGATACAGTA / ATTTTCAAAGAACCATCCATG...GGGCTTATGGAATGGTAG / ATAGTTGAGACACAGAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GAAACTTGTTCTGATACAGTA / ATTTTCAAAGAACCATCCATG...GGGCTTATGGAATGGTAG / ATAGTTGAGACACAGAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00027557 Copy   


  • RRID:WB-STRAIN:WBStrain00027558

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027558

Source Database: WormBase (WB)
Affected Genes: WBGene00006697(uaf-1)
Genomic Alteration: WBGene00006697(uaf-1)
Availability: available
Source References: EMPTY
Synonyms: uaf-1(n4588) III.
Alternate IDs: WB-STRAIN:MT16492, CGC_MT16492
Notes: Suppressor of unc-93(e1500). Weak maternal effect sterile and dumpy. Reference: Ma L, Horvitz HR. PLoS Genet. 2009 Nov;5(11):e1000708.

Proper citation: RRID:WB-STRAIN:WBStrain00027558 Copy   


  • RRID:WB-STRAIN:WBStrain00027553

http://www.wormbase.org/db/get?name=WBStrain00027553

Source Database: WormBase (WB)
Affected Genes: WBGene00003339(mir-245)
Genomic Alteration: WBGene00003339(mir-245)
Availability: available
Source References: EMPTY
Synonyms: mir-245(n4798) I.
Alternate IDs: WB-STRAIN:MT16337, CGC_MT16337
Notes: Deletion breakpoints are:AACCTTAATAAACAAATTTTA / TTAGATTTGTTTCTGAA...GATAGTGACTTTCTTGAC / AAAACTTCCTAGCGCCATCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:AACCTTAATAAACAAATTTTA / TTAGATTTGTTTCTGAA...GATAGTGACTTTCTTGAC / AAAACTTCCTAGCGCCATCT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00027553 Copy   


  • RRID:WB-STRAIN:WBStrain00027555

http://www.wormbase.org/db/get?name=WBStrain00027555

Source Database: WormBase (WB)
Affected Genes: WBGene00003004(lin-15)|WBGene00008206(set-6)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00003004(lin-15), WBGene00008206(set-6), WBGene00023498(lin-15A)
Availability: available
Source References: EMPTY
Synonyms: set-6(tm1611) lin-15A(n767) X.
Alternate IDs: WB-STRAIN:MT16429, CGC_MT16429
Notes: Mutagen:TMP+UV|"Mutagen:TMP/UV"|"Reference: Andersen EC & Horvitz HR., Development. 2007 Aug;134(16):2991-9."

Proper citation: RRID:WB-STRAIN:WBStrain00027555 Copy   


  • RRID:WB-STRAIN:WBStrain00027546

http://www.wormbase.org/db/get?name=WBStrain00027546

Source Database: WormBase (WB)
Affected Genes: WBGene00003341(mir-247)|WBGene00045358(mir-797)
Genomic Alteration: WBGene00003341(mir-247), WBGene00045358(mir-797)
Availability: available
Source References: EMPTY
Synonyms: mir-247&mir-797(n4505) X.
Alternate IDs: WB-STRAIN:MT16309, CGC_MT16309
Notes: Deletion breakpoints are: CCAGTGTTACCACCGCTTGCTACAAACGGC / AAAAAATTTGAA...CAAAAATTTAT / CACATGAAATTATACCAAACAGTCAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"

Proper citation: RRID:WB-STRAIN:WBStrain00027546 Copy   


  • RRID:WB-STRAIN:WBStrain00027548

http://www.wormbase.org/db/get?name=WBStrain00027548

Source Database: WormBase (WB)
Affected Genes: WBGene00003305(mir-77)
Genomic Alteration: WBGene00003305(mir-77)
Availability: available
Source References: EMPTY
Synonyms: mir-77(n4286) II.
Alternate IDs: WB-STRAIN:MT16311, CGC_MT16311
Notes: Deletion breakpoints are:CTACAAAAACTATTCCATTC / AAAAAACGGCTGTCAGTGC...AGAGACGATTTGTGTCGA / TTTACGAAATTTTCCTCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CTACAAAAACTATTCCATTC / AAAAAACGGCTGTCAGTGC...AGAGACGATTTGTGTCGA / TTTACGAAATTTTCCTCG.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00027548 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Kravitz Dataset1 Resources

    Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within Kravitz that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X