Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MT14401 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027457 | Caenorhabditis elegans | set-12(n4442) X. | Deletion of K09F5.5, a putative SET-domain-encoding gene. From 2002 deletion library. This deletion removes from the middle of the second exon to the middle of the fourth exon. It is predicted to remove exons that encode the AWS, SET and PostSET domains. | WBGene00019584(set-12) | WBGene00019584(set-12) | WB-STRAIN:WBStrain00027457 | WormBase (WB) | WB | available | WB-STRAIN:MT14401, CGC_MT14401 | 2026-09-12 11:15:30 | 0 | |||
|
MT14119 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027450 | Caenorhabditis elegans | nDf50 II. | Made_by: Horvitz Lab|"Partially penetrant embryonic lethal phenotype. mir-35 though mir-41 are deleted in nDf50. Deletion breakpoints are: TGGTTTCTTCCACAGTGGTACTTTCCATTA / GAACTATCACCGGGT...GGGTCAAATGTTTATA / CAGTTGTGCTACTAAACGTATTGTTACACG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Partially penetrant embryonic lethal phenotype. mir-35 though mir-41 are deleted in nDf50. Deletion breakpoints are: TGGTTTCTTCCACAGTGGTACTTTCCATTA / GAACTATCACCGGGT...GGGTCAAATGTTTATA / CAGTTGTGCTACTAAACGTATTGTTACACG.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects." | WB-STRAIN:WBStrain00027450 | WormBase (WB) | WB | available | WB-STRAIN:MT14119, CGC_MT14119 | 2026-09-12 11:15:30 | 0 | |||||
|
MT14128 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027451 | Caenorhabditis elegans | nDf53 III; nDf54 X. | Removes mir-80, mir-81, mir-82, mir-227, and T07D1.2 (exons 2-6). Reference: Alvarez-Saavedra E, Horvitz HR. Curr Biol. 2010 Feb 23;20(4):367-73. | WB-STRAIN:WBStrain00027451 | WormBase (WB) | WB | available | WB-STRAIN:MT14128, CGC_MT14128 | 2026-09-12 11:15:30 | 0 | |||||
|
MT14347 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027453 | Caenorhabditis elegans | mir-273(n4438) II. | Deletion breakpoints are:TGGTACTGGCCCCACTTTGATAGT / CTCAAGGCTT...TTAGCGCTAT / AAAAATTTGTACATCTCTGCTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:TGGTACTGGCCCCACTTTGATAGT / CTCAAGGCTT...TTAGCGCTAT / AAAAATTTGTACATCTCTGCTC.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP" | WBGene00003366(mir-273) | WBGene00003366(mir-273) | WB-STRAIN:WBStrain00027453 | WormBase (WB) | WB | available | WB-STRAIN:MT14347, CGC_MT14347 | 2026-09-12 11:15:30 | 0 | |||
|
MT14091 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027447 | Caenorhabditis elegans | mir-79(n4126) I. | Deletion breakpoints are:TATCTTCTTATTCGGGGCGTCCTTG / TACCTATCTTG...AAATTTTCTGTA / GGTCTTAAATTTTTTCCTAACAAAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:TATCTTCTTATTCGGGGCGTCCTTG / TACCTATCTTG...AAATTTTCTGTA / GGTCTTAAATTTTTTCCTAACAAAAAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP" | WBGene00003307(mir-79) | WBGene00003307(mir-79) | WB-STRAIN:WBStrain00027447 | WormBase (WB) | WB | available | WB-STRAIN:MT14091, CGC_MT14091 | 2026-09-12 11:15:30 | 0 | |||
|
MT14118 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027449 | Caenorhabditis elegans | mir-241(n4315) V; mir-84(n4037) X. | Superficially WT. | WBGene00003312(mir-84)|WBGene00003335(mir-241) | WBGene00003312(mir-84), WBGene00003335(mir-241) | WB-STRAIN:WBStrain00027449 | WormBase (WB) | WB | available | WB-STRAIN:MT14118, CGC_MT14118 | 2026-09-12 11:15:30 | 0 | |||
|
MT13952 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027444 | Caenorhabditis elegans | lgc-53(n4330) X. | 1.463 kb deletion in T21F2.1 encoding ligand-gated chloride channel. Homozygous viable.|"WBStrain mapped, WBPaper00059778 added based on AFP_Strain data." | WBGene00020657(lgc-53) | WBGene00020657(lgc-53) | WB-STRAIN:WBStrain00027444 | WormBase (WB) | WB | available | PMID:32510332 | WB-STRAIN:MT13952, CGC_MT13952 | 2026-09-12 11:15:30 | 0 | ||
|
MT13971 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027446 | Caenorhabditis elegans | hpl-1(n4317) X. | Deletion removes the first exon with the start codon and nearly all of the exonic sequence except the last exon. | WBGene00001995(hpl-1) | WBGene00001995(hpl-1) | WB-STRAIN:WBStrain00027446 | WormBase (WB) | WB | available | WB-STRAIN:MT13971, CGC_MT13971 | 2026-09-12 11:15:30 | 0 | |||
|
MT14752 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027483 | Caenorhabditis elegans | nDf50 nDf49 II; nEx1188. | Made_by: Ezequiel Alvarez-Saa|"nEx1188 [mir-35 mir-45(genomic) + sur-5::GFP]. Maintain by picking GFP+. Array rescues nDf50 nDf49 (mir-35 mir-45) lethality. Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73." | WB-STRAIN:WBStrain00027483 | WormBase (WB) | WB | available | WB-STRAIN:MT14752, CGC_MT14752 | 2026-09-12 11:15:31 | 0 | |||||
|
MT14728 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027480 | Caenorhabditis elegans | mfap-1(n4564 n5214) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP mfap-1 homozygotes. Pick WT GFP and check for correct segregation of progeny to maintain. mfap-1(n4564 n5214) mutants exhibit temperature-sensitive lethality: at 15C, (n4564 n5214) homozygous animals grow and behave similarly to wild-type; at 20C mutant animals grow more slowly, have few progeny and are hyperactive; at 25C the mutant strain is embryonically lethal. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Ma L, et al. PLoS Genet. 2012;8(7):e1002827.|"Segregates WT green-glowing heterozygotes and non-glowing mfap-1 homozygotes. mfap-1(n4564 n5214) mutants exhibit temperature-sensitive lethality: at 15C, (n4564 n5214) homozygous animals grow and behave similarly to wild-type; at 20C mutant animals grow more slowly, have few progeny and are hyperactive; at 25C the mutant strain is embryonically lethal. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Ma L, et al. PLoS Genet. 2012;8(7):e1002827." | WBGene00000254(bli-4)|WBGene00009671(mfap-1) | WBGene00000254(bli-4), WBGene00009671(mfap-1) | WB-STRAIN:WBStrain00027480 | WormBase (WB) | WB | available | WB-STRAIN:MT14728, CGC_MT14728 | 2026-09-12 11:15:31 | 1 | |||
|
MT14748 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027481 | Caenorhabditis elegans | nDf51 V; nEx1184. | nEx1184 [sur-5::GFP]. Maintain by picking GFP+. nEx1184 rescues the lethality and extra seam cells in nDf51. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).|"nEx1184 [sur-5::GFP]. nEx1184 rescues the lethality and extra seam cells in nDf51, a deletion of mir-48 and mir-241. Maintain by picking GFP+." | WB-STRAIN:WBStrain00027481 | WormBase (WB) | WB | available | WB-STRAIN:MT14748, CGC_MT14748 | 2026-09-12 11:15:31 | 0 | |||||
|
MT14678 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027476 | Caenorhabditis elegans | lgc-40(n4545) X. | 1.029 kb deletion in T24D8.1 encoding ligand-gated chloride channel that is a low affinity serotonin receptor. Homozygous viable. | WBGene00020767(lgc-40) | WBGene00020767(lgc-40) | WB-STRAIN:WBStrain00027476 | WormBase (WB) | WB | available | WB-STRAIN:MT14678, CGC_MT14678 | 2026-09-12 11:15:31 | 0 | |||
|
MT14682 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027478 | Caenorhabditis elegans | mir-257(n4548) V. | Deletion breakpoints are:GACCTTGGACTTCAGCACATCCGGTTTTCCA / CTCGGAACTTGACG....CCTGCAGTTCTTCCAT / GATGTACTCAGGGCCTTTAATTTTGTACATGCTCCATAGGAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GACCTTGGACTTCAGCACATCCGGTTTTCCA / CTCGGAACTTGACG....CCTGCAGTTCTTCCAT / GATGTACTCAGGGCCTTTAATTTTGTACATGCTCCATAGGAT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP" | WBGene00003351(mir-257) | WBGene00003351(mir-257) | WB-STRAIN:WBStrain00027478 | WormBase (WB) | WB | available | WB-STRAIN:MT14682, CGC_MT14682 | 2026-09-12 11:15:31 | 0 | |||
|
MT14662 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027472 | Caenorhabditis elegans | mir-230(n4535) X. | Deletion breakpoints are:ACATCATCATCATAACAA / GCCTTTCACAAATAAGATC...ACTTATATTTCTTGTTTATTTTTTT / AAATGTTTTTTTTACTATTGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:ACATCATCATCATAACAA / GCCTTTCACAAATAAGATC...ACTTATATTTCTTGTTTATTTTTTT / AAATGTTTTTTTTACTATTGC.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab" | WBGene00003323(mir-230) | WBGene00003323(mir-230) | WB-STRAIN:WBStrain00027472 | WormBase (WB) | WB | available | PMID:38594249 | WB-STRAIN:MT14662, CGC_MT14662 | 2026-09-12 11:15:31 | 0 | ||
|
MT14666 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027473 | Caenorhabditis elegans | egl-6(n4537) X. | 2201 bp deletion in C46F4.1. Reference: Ringstad N, Horvitz HR. Nat Neurosci. 2008 Oct;11(10):1168-76.|"Supplementary_genotype egl-6(n4537lf)" | WBGene00001175(egl-6) | WBGene00001175(egl-6) | WB-STRAIN:WBStrain00027473 | WormBase (WB) | WB | available | PMID:37769660 | WB-STRAIN:MT14666, CGC_MT14666 | 2026-09-12 11:15:31 | 3 | ||
|
MT14615 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027470 | Caenorhabditis elegans | set-16(n4526)/qC1 [dpy-19(e1259) glp-1(q339)] III. | Mutagen:UV/TMP|"T12D8.1 deletion. Putative HMTase-encoding gene, from F21E9 (2001 library). Heterozygotes are WT, and segregate Dpy Steriles (qC1 homozygotes) and larval lethals (set-16 homozygotes)." | WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00011729(set-16) | WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00011729(set-16) | WB-STRAIN:WBStrain00027470 | WormBase (WB) | WB | available | WB-STRAIN:MT14615, CGC_MT14615 | 2026-09-12 11:15:31 | 0 | |||
|
MT14661 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027471 | Caenorhabditis elegans | mir-265(n4534) IV. | Deletion breakpoints are:ACTTTCGAAAAATTTTGCCAT / GTTTTCCAATTT...TATTATTTTCAGAAA / GCCAAAATATTTCTAAATTCCTATATAAATTTCAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:ACTTTCGAAAAATTTTGCCAT / GTTTTCCAATTT...TATTATTTTCAGAAA / GCCAAAATATTTCTAAATTCCTATATAAATTTCAAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab" | WBGene00003358(mir-265) | WBGene00003358(mir-265) | WB-STRAIN:WBStrain00027471 | WormBase (WB) | WB | available | WB-STRAIN:MT14661, CGC_MT14661 | 2026-09-12 11:15:31 | 0 | |||
|
MT14588 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027469 | Caenorhabditis elegans | mir-234(n4520) II. | Deletion breakpoints are:CAACGTTTCCAAACTGT / AACGTAAATATACAACAC...TGATGGGGGGGGGGGGTCAAGGAAA / GAAGAAAAGGGAAGAAAGAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CAACGTTTCCAAACTGT / AACGTAAATATACAACAC...TGATGGGGGGGGGGGGTCAAGGAAA / GAAGAAAAGGGAAGAAAGAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab" | WBGene00003327(mir-234) | WBGene00003327(mir-234) | WB-STRAIN:WBStrain00027469 | WormBase (WB) | WB | available | WB-STRAIN:MT14588, CGC_MT14588 | 2026-09-12 11:15:31 | 0 | |||
|
MT14531 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027467 | Caenorhabditis elegans | prg-2(nDf57) IV. | Deletion breakpoints: ATCGGGATGAAGTTTGCAAA | WBGene00004179(prg-2) | WBGene00004179(prg-2) | WB-STRAIN:WBStrain00027467 | WormBase (WB) | WB | available | WB-STRAIN:MT14531, CGC_MT14531 | 2026-09-12 11:15:31 | 0 | |||
|
MT14984 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027500 | Caenorhabditis elegans | tph-1(n4622) II. | Egl. Reduced pharyngeal pumping.|"Made_by: Dan Omura"|"WBStrain provided so WBPaper00060405 paper added based on AFP_Strain data." | WBGene00006600(tph-1) | WBGene00006600(tph-1) | WB-STRAIN:WBStrain00027500 | WormBase (WB) | WB | available | PMID:33007049 PMID:36653384 PMID:37155851 PMID:38302462 PMID:38555276 |
WB-STRAIN:MT14984, CGC_MT14984 | 2026-09-12 11:15:31 | 6 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
