Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MT12839 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027404 | Caenorhabditis elegans | lin-61(n3809) I; lin-8(n2731) II. | SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71. | WBGene00002997(lin-8)|WBGene00003041(lin-61) | WBGene00002997(lin-8), WBGene00003041(lin-61) | WB-STRAIN:WBStrain00027404 | WormBase (WB) | WB | available | WB-STRAIN:MT12839, CGC_MT12839 | 2026-09-12 11:15:30 | 0 | |||
|
MT14768 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027487 | Caenorhabditis elegans | mir-231(n4571) III. | Deletion breakpoints are: CATAAATTTCAGGAAAGC / ATGTGGTAAAATATGAAT...ATGTGAATGAAAATAAACC / GCCAAAAATATCAAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"|"Mutagen:UV/TMP" | WBGene00003324(mir-231) | WBGene00003324(mir-231) | WB-STRAIN:WBStrain00027487 | WormBase (WB) | WB | available | WB-STRAIN:MT14768, CGC_MT14768 | 2026-09-12 11:15:31 | 1 | |||
|
MT13650 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027436 | Caenorhabditis elegans | mir-48(n4097) V. | Mutagen:UV/TMP|"Worms are weakly retarded, with cold-sensitive supernumerary adult-stage molt phenotype (<5% at 20C, about 70% at 15C). 293 bp deletion encompassing the lin-58 gene. lin-58 is at 5908 to 5885 of F56A12. Deletion goes from -45 to +248 from start of lin-58."|"Worms are weakly retarded, with cold-sensitive supernumerary adult-stage molt phenotype (<5% at 20C, about 70% at 15C). 293 bp deletion encompassing the mir-48 gene. mir-48 is at 5908 to 5885 of F56A12. Deletion goes from -45 to +248 from start of mir-48." | WBGene00003039(mir-48) | WBGene00003039(mir-48) | WB-STRAIN:WBStrain00027436 | WormBase (WB) | WB | available | WB-STRAIN:MT13650, CGC_MT13650 | 2026-09-12 11:15:30 | 0 | |||
|
MT13651 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027437 | Caenorhabditis elegans | mir-84(n4037) X. | Mutagen:UV/TMP|"Superficially WT. mir-84 deletion is between 2891 and 3682 of clone B0395. mir-84 is at 3351-3330 in B0395." | WBGene00003312(mir-84) | WBGene00003312(mir-84) | WB-STRAIN:WBStrain00027437 | WormBase (WB) | WB | available | WB-STRAIN:MT13651, CGC_MT13651 | 2026-09-12 11:15:30 | 0 | |||
|
MT13653 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027439 | Caenorhabditis elegans | mir-237(n4296) X. | Deletion breakpoints are:GAAGATCATTCTTAAATCTGTTTAGCA / TTTTGAAAGTTT...ACTGCATTAGAACT / GCAAAAAAAAGTTTCGAGAAAAGTGGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GAAGATCATTCTTAAATCTGTTTAGCA / TTTTGAAAGTTT...ACTGCATTAGAACT / GCAAAAAAAAGTTTCGAGAAAAGTGGCT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP" | WBGene00003330(mir-237) | WBGene00003330(mir-237) | WB-STRAIN:WBStrain00027439 | WormBase (WB) | WB | available | WB-STRAIN:MT13653, CGC_MT13653 | 2026-09-12 11:15:30 | 0 | |||
|
MT13433 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027432 | Caenorhabditis elegans | mir-45(n4280) II. | Deletion breakpoints are:TCCACCAGCAAAAAGCCGT / CTCCAAAGAAGGCTGCTCCG...AAAAAACTACAAATTCTCG / TTTCCATTACTTTTCAGAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:TCCACCAGCAAAAAGCCGT / CTCCAAAGAAGGCTGCTCCG...AAAAAACTACAAATTCTCG / TTTCCATTACTTTTCAGAAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab" | WBGene00003273(mir-45) | WBGene00003273(mir-45) | WB-STRAIN:WBStrain00027432 | WormBase (WB) | WB | available | PMID:38594249 | WB-STRAIN:MT13433, CGC_MT13433 | 2026-09-12 11:15:30 | 0 | ||
|
MT13372 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027430 | Caenorhabditis elegans | nDf49 II. | Made_by: Horvitz Lab|"mir-42, mir43 and mir-44 are deleted in nDf49. Deletion breakpoints are:GGAGCTTGCACTTCCAAAAC / CCGACGATCTGAGAAATCC...GCTATGTATCAATCTACG / CGATAGCTAGAAAAAAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"mir-42, mir43 and mir-44 are deleted in nDf49. Deletion breakpoints are:GGAGCTTGCACTTCCAAAAC / CCGACGATCTGAGAAATCC...GCTATGTATCAATCTACG / CGATAGCTAGAAAAAAAT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects." | WB-STRAIN:WBStrain00027430 | WormBase (WB) | WB | available | WB-STRAIN:MT13372, CGC_MT13372 | 2026-09-12 11:15:30 | 0 | |||||
|
MT13293 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027429 | Caenorhabditis elegans | met-2(n4256) III | Deletion of R05D3.11.|"Reference WBPaper00059681 added based on published strain data identified by Textpresso literature search." | WBGene00019883(met-2) | WBGene00019883(met-2) | WB-STRAIN:WBStrain00027429 | WormBase (WB) | WB | available | PMID:31815663 PMID:32451438 PMID:34648748 |
WB-STRAIN:MT13293, CGC_MT13293 | 2026-09-12 11:15:30 | 3 | ||
|
MT13172 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027425 | Caenorhabditis elegans | mys-1(n4075) V/nT1 [qIs51] (IV;V). | Heterozygotes are WT and GFP+ and segregate Ste GFP- and dead eggs. The myo-1(n4075) deletion removes 1010 nucleotides from the mys-1 locus (VC5.4). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 106 and ends at about nt. 1115 to give the junction sequence GATGCCGGT/TCTGCGTGGG.|"Mutagen:UV/TMP" | WBGene00007029(mys-1) | WBGene00007029(mys-1) | WB-STRAIN:WBStrain00027425 | WormBase (WB) | WB | available | WB-STRAIN:MT13172, CGC_MT13172 | 2026-09-12 11:15:30 | 0 | |||
|
MT13232 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027427 | Caenorhabditis elegans | lin-65(n3441) I. | EMPTY | WBGene00022149(lin-65) | WBGene00022149(lin-65) | WB-STRAIN:WBStrain00027427 | WormBase (WB) | WB | available | WB-STRAIN:MT13232, CGC_MT13232 | 2026-09-12 11:15:30 | 3 | |||
|
MT13292 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027428 | Caenorhabditis elegans | mir-124(n4255) IV. | Deletion breakpoints are:GTCGCTCATTGATTCACATCCATTTTGAG / AAGGATGGTT...GAATGCCACGTG / GCCATGATGGGGCTCCCATTGAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GTCGCTCATTGATTCACATCCATTTTGAG / AAGGATGGTT...GAATGCCACGTG / GCCATGATGGGGCTCCCATTGAAT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP" | WBGene00003319(mir-124) | WBGene00003319(mir-124) | WB-STRAIN:WBStrain00027428 | WormBase (WB) | WB | available | WB-STRAIN:MT13292, CGC_MT13292 | 2026-09-12 11:15:30 | 0 | |||
|
MT13032 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027422 | Caenorhabditis elegans | sli-1(n3538) X. | SynMuv. | WBGene00004829(sli-1) | WBGene00004829(sli-1) | WB-STRAIN:WBStrain00027422 | WormBase (WB) | WB | available | WB-STRAIN:MT13032, CGC_MT13032 | 2026-09-12 11:15:30 | 0 | |||
|
MT14450 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027461 | Caenorhabditis elegans | mir-51(n4473) IV. | Deletion breakpoints are: TTTGAATGAATATCTGGTTACCAAAA / CAATTACCA...CCAAAACATACGGT / TGTGAAAGGAAAGAAAAGCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members" | WBGene00003279(mir-51) | WBGene00003279(mir-51) | WB-STRAIN:WBStrain00027461 | WormBase (WB) | WB | available | WB-STRAIN:MT14450, CGC_MT14450 | 2026-09-12 11:15:31 | 0 | |||
|
MT14451 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027462 | Caenorhabditis elegans | mir-76(n4474) III. | Deletion breakpoints are:ATGTCTTAATTTCTAGT / GGAGCTATTGATTTTCGAAA...TGGCCTCGATTTTCTTCT / CGCAATATGGATCGTTGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:ATGTCTTAATTTCTAGT / GGAGCTATTGATTTTCGAAA...TGGCCTCGATTTTCTTCT / CGCAATATGGATCGTTGC.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP" | WBGene00003304(mir-76) | WBGene00003304(mir-76) | WB-STRAIN:WBStrain00027462 | WormBase (WB) | WB | available | WB-STRAIN:MT14451, CGC_MT14451 | 2026-09-12 11:15:31 | 1 | |||
|
MT14480 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027464 | Caenorhabditis elegans | set-11(n4488) II. | Deletion allele. Reference: Andersen EC, Horvitz HR. Development. 2007 Aug;134(16):2991-9. | WBGene00018023(set-11) | WBGene00018023(set-11) | WB-STRAIN:WBStrain00027464 | WormBase (WB) | WB | available | WB-STRAIN:MT14480, CGC_MT14480 | 2026-09-12 11:15:31 | 0 | |||
|
MT14449 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027460 | Caenorhabditis elegans | mir-232(nDf56) IV. | Deletion breakpoints are: GATGTATTGGGAGTCTTTTTAGGT / TATGGACCAGG...TTTCGTGCGT / CACTTTTTTTATAAGCTCTACCGTATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members" | WBGene00003325(mir-232) | WBGene00003325(mir-232) | WB-STRAIN:WBStrain00027460 | WormBase (WB) | WB | available | WB-STRAIN:MT14449, CGC_MT14449 | 2026-09-12 11:15:31 | 0 | |||
|
MT14446 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027458 | Caenorhabditis elegans | mir-228(n4382) IV. | Deletion breakpoints are: GTACACAGAACAATAGAAATCGCCT / CGTTTCTGTTT...CTACGATATTAT / GTCCGAATTAAATTGCTTTTTTTTTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"|"Mutagen:UV/TMP" | WBGene00003321(mir-228) | WBGene00003321(mir-228) | WB-STRAIN:WBStrain00027458 | WormBase (WB) | WB | available | WB-STRAIN:MT14446, CGC_MT14446 | 2026-09-12 11:15:31 | 1 | |||
|
MT14448 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027459 | Caenorhabditis elegans | mir-79(n4126) I; mir-75(n4472) X. | Reference: Curr Bio (2010) doi:10.1016/j.cub.2009.12.051. | WBGene00003303(mir-75)|WBGene00003307(mir-79) | WBGene00003303(mir-75), WBGene00003307(mir-79) | WB-STRAIN:WBStrain00027459 | WormBase (WB) | WB | available | WB-STRAIN:MT14448, CGC_MT14448 | 2026-09-12 11:15:31 | 0 | |||
|
MT14355 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027454 | Caenorhabditis elegans | ftt-2(n4426) X. | Mutagen:UV/TMP|"Superficially WT. Low brood size. Usually bag at day 2-3 of adulthood. 650nt deletion takes out a promoter and an ATG; predicted to be a molecular null." | WBGene00001502(ftt-2) | WBGene00001502(ftt-2) | WB-STRAIN:WBStrain00027454 | WormBase (WB) | WB | available | WB-STRAIN:MT14355, CGC_MT14355 | 2026-09-12 11:15:30 | 1 | |||
|
MT14378 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027455 | Caenorhabditis elegans | met-2(n4256) III; hpl-1(n4317) X. | EMPTY | WBGene00001995(hpl-1)|WBGene00019883(met-2) | WBGene00001995(hpl-1), WBGene00019883(met-2) | WB-STRAIN:WBStrain00027455 | WormBase (WB) | WB | available | WB-STRAIN:MT14378, CGC_MT14378 | 2026-09-12 11:15:30 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
