Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00031934
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00000536(clk-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00000536(clk-1)
Availability: available
Source References: EMPTY
Synonyms: clk-1(ok1247) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:RB1234, CGC_RB1234
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZC395.2 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. ok1247 animals are homozygous viable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: CGGGTTTCGCACTATTTTGT. Outer Right Sequence: CAGCTACCGTACCCGACATT. Inner Left Sequence: GCTGGCCCAGTACATTTGTT. Inner Right Sequence: CAGTGTTCCGGATTTCAGGT. Inner Primer PCR Length: . Estimated Deletion Size: about 1250 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype."
Proper citation: RRID:WB-STRAIN:WBStrain00031934 Copy
http://www.wormbase.org/db/get?name=WBStrain00031933
Source Database: WormBase (WB)
Affected Genes: WBGene00020708(dmd-8)
Genomic Alteration: WBGene00020708(dmd-8)
Availability: available
Source References: EMPTY
Synonyms: T22H9.4(ok1294) V.
Alternate IDs: WB-STRAIN:RB1233, CGC_RB1233
Notes: Made_by: OMRF Knockout Group|"T22H9.4 Homozygous. Outer Left Sequence: gtggctgaaaattcggaaaa. Outer Right Sequence: tactgatccgcgtaaaaccc. Inner Left Sequence: aaaatcaatcggtttcagcg. Inner Right Sequence: gcggagacgttagacatggt. Inner Primer PCR Length: 2135. Estimated Deletion Size: about 600 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031933 Copy
http://www.wormbase.org/db/get?name=WBStrain00031932
Source Database: WormBase (WB)
Affected Genes: WBGene00019394(K04F10.1)
Genomic Alteration: WBGene00019394(K04F10.1)
Availability: available
Source References: EMPTY
Synonyms: K04F10.1(ok1291) I.
Alternate IDs: WB-STRAIN:RB1232, CGC_RB1232
Notes: K04F10.1 Homozygous. Outer Left Sequence: TGGTGAAATTCCATCAAGCA. Outer Right Sequence: GCATTGAGCTGTGCTGAAAA. Inner Left Sequence: AGTGGAAACCGAAGTTGTGC. Inner Right Sequence: CTCGAGCGAGTCGAGTTTTT. Inner Primer PCR Length: 2128. Estimated Deletion Size: about 1200 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031932 Copy
http://www.wormbase.org/db/get?name=WBStrain00031930
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00018632(tag-296)
Genomic Alteration: WBGene00000254(bli-4), WBGene00018632(tag-296)
Availability: available
Source References: EMPTY
Synonyms: F49D11.9(ok1190) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:RB1230, CGC_RB1230
Notes: F49D11.9 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: aattgccaactgccgattat. Outer Right Sequence: tcggggagtacacaggctac. Inner Left Sequence: aagaacttcagagttgccgc. Inner Right Sequence: cgagctccataaaatcgcat. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 900 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031930 Copy
http://www.wormbase.org/db/get?name=WBStrain00031938
Source Database: WormBase (WB)
Affected Genes: WBGene00001976(hmg-11)
Genomic Alteration: WBGene00001976(hmg-11)
Availability: available
Source References: EMPTY
Synonyms: hmg-11(ok1303) II.
Alternate IDs: WB-STRAIN:RB1238, CGC_RB1238
Notes: Made_by: OMRF Knockout Group|"T05A7.4 Homozygous. Outer Left Sequence: ctcgtggaagccctagacag. Outer Right Sequence: catcgggaaagtacggaaga. Inner Left Sequence: tcagatggtatgatcgccaa. Inner Right Sequence: tcagactgtcacatcgctcc. Inner Primer PCR Length: 2185. Estimated Deletion Size: about 500 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031938 Copy
http://www.wormbase.org/db/get?name=WBStrain00031937
Source Database: WormBase (WB)
Affected Genes: WBGene00015177(tmc-2)
Genomic Alteration: WBGene00015177(tmc-2)
Availability: available
Source References: EMPTY
Synonyms: B0416.1(ok1302) X.
Alternate IDs: WB-STRAIN:RB1237, CGC_RB1237
Notes: B0416.1 Homozygous. Outer Left Sequence: gcttcaaaaatagggcctcc. Outer Right Sequence: tttatttggatcagcccagc. Inner Left Sequence: cgtcagcacgcttttaatca. Inner Right Sequence: aggtacaaattggcgacctg. Inner Primer PCR Length: 3349. Estimated Deletion Size: about 1300 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031937 Copy
http://www.wormbase.org/db/get?name=WBStrain00031936
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00004959(spe-5)
Genomic Alteration: WBGene00000254(bli-4), WBGene00004959(spe-5)
Availability: available
Source References: EMPTY
Synonyms: Y110A7A.12(ok1054) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:RB1236, CGC_RB1236
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y110A7A.12 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. ok1054 animals are homozygous viable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: GAAACACACAGGAACGGGAT. Outer Right Sequence: AATCGGCGTTTTTCAGAATG. Inner Left Sequence: TGGCAGAAGATGATCCAGTG. Inner Right Sequence: GCGTGGATCTCGATTACGAT. Inner Primer PCR Length: 2442. Estimated Deletion Size: about 1300 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype."
Proper citation: RRID:WB-STRAIN:WBStrain00031936 Copy
http://www.wormbase.org/db/get?name=WBStrain00031981
Source Database: WormBase (WB)
Affected Genes: WBGene00016100(C25E10.11)
Genomic Alteration: WBGene00016100(C25E10.11)
Availability: available
Source References: EMPTY
Synonyms: C25E10.11(ok1380) V.
Alternate IDs: WB-STRAIN:RB1282, CGC_RB1282
Notes: C25E10.11 Homozygous. Outer Left Sequence: cttggtgagaccggagagag. Outer Right Sequence: tggcatgcaatgtcattttt. Inner Left Sequence: agccgaccggaatatttctt. Inner Right Sequence: actaattttcgaatgccccc. Inner Primer PCR Length: 2466. Estimated Deletion Size: about 1800 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031981 Copy
http://www.wormbase.org/db/get?name=WBStrain00031989
Source Database: WormBase (WB)
Affected Genes: WBGene00003800(npp-14)
Genomic Alteration: WBGene00003800(npp-14)
Availability: available
Source References: EMPTY
Synonyms: npp-14(ok1389) I.
Alternate IDs: WB-STRAIN:RB1290, CGC_RB1290
Notes: C03D6.4 Homozygous. Outer Left Sequence: ccaccaaaaagccatgaact. Outer Right Sequence: aatcggaaaatttggtgctg. Inner Left Sequence: cttcggtgcaaacggattat. Inner Right Sequence: attcgctgggaaaaattgtg. Inner Primer PCR Length: 3334. Estimated Deletion Size: about 1400 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031989 Copy
http://www.wormbase.org/db/get?name=WBStrain00031988
Source Database: WormBase (WB)
Affected Genes: WBGene00008065(npr-18)
Genomic Alteration: WBGene00008065(npr-18)
Availability: available
Source References: PMID:38446031
Synonyms: C43C3.2(ok1388) X.
Alternate IDs: WB-STRAIN:RB1289, CGC_RB1289
Notes: C43C3.2 Homozygous. Outer Left Sequence: catacccaagtacgcgtgaa. Outer Right Sequence: tgaaagtcaactggtggcag. Inner Left Sequence: ccacgtcgcctgttaagttt. Inner Right Sequence: acagttgcagaagcgagaca. Inner Primer PCR Length: 2850. Estimated Deletion Size: about 900 bp. Breakpoint data provided by Neline Kriek 10/2004: AAGTCANCACTGGAATGCATCTGTATAAGTGTGTCGATGATCTTGGTCGCGAGTTGTTT GTTGTATTTACTTTGTACTbreakpointACGACGAACACCCGACCTGAATATAGCGAG CTAATCGCAATACGTAAGTTGTTATCATTCAAGTT.|"C43C3.2 Homozygous. Outer Left Sequence: catacccaagtacgcgtgaa. Outer Right Sequence: tgaaagtcaactggtggcag. Inner Left Sequence: ccacgtcgcctgttaagttt. Inner Right Sequence: acagttgcagaagcgagaca. Inner Primer PCR Length: 2850. Estimated Deletion Size: about 900 bp. Breakpoint data provided by Neline Kriek 10/2004: AAGTCANCACTGGAATGCATCTGTATAAGTGTGTCGATGATCTTGGTCGCGAGTTGTTTGTTGTATTTACTTTGTACTbreakpointACGACGAACACCCGACCTGAATATAGCGAGCTAATCGCAATACGTAAGTTGTTATCATTCAAGTT."|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031988 Copy
http://www.wormbase.org/db/get?name=WBStrain00031986
Source Database: WormBase (WB)
Affected Genes: WBGene00012162(sek-6)
Genomic Alteration: WBGene00012162(sek-6)
Availability: available
Source References: EMPTY
Synonyms: VZC374L.1(ok1386) X.
Alternate IDs: WB-STRAIN:RB1287, CGC_RB1287
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"VZC374L.1 Homozygous. Outer Left Sequence: tttgcttttcgaggcatttt. Outer Right Sequence: tgaatcagcaagattgacgg. Inner Left Sequence: gcgtaaatttccggttacga. Inner Right Sequence: tcaagctctctgctcgactg. Inner Primer PCR Length: 2166. Estimated Deletion Size: about 1100 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00031986 Copy
http://www.wormbase.org/db/get?name=WBStrain00031984
Source Database: WormBase (WB)
Affected Genes: WBGene00003096(lys-7)
Genomic Alteration: WBGene00003096(lys-7)
Availability: available
Source References: PMID:30889411
Synonyms: lys-7(ok1384) V.
Alternate IDs: WB-STRAIN:RB1285, CGC_RB1285
Notes: C02A12.4 Homozygous. Outer Left Sequence: ggtttccaaaaagccaacaa. Outer Right Sequence: gtattcagaacgtggcggtt. Inner Left Sequence: tccatcaaaattggcaacaa. Inner Right Sequence: cggcgaaataaattttggaa. Inner Primer PCR Length: 2354. Estimated Deletion Size: about 700 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031984 Copy
http://www.wormbase.org/db/get?name=WBStrain00031908
Source Database: WormBase (WB)
Affected Genes: WBGene00000534(cpi-2)
Genomic Alteration: WBGene00000534(cpi-2)
Availability: available
Source References: PMID:34090505
Synonyms: cpi-2(ok1256) V.
Alternate IDs: WB-STRAIN:RB1207, CGC_RB1207
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"R01B10.1 Homozygous. Outer Left Sequence: attccgataacattggctgg. Outer Right Sequence: aatctgttgccgacaaaacc. Inner Left Sequence: attttctggccaatttcgtg. Inner Right Sequence: ccacaattccaatcccaatc. Inner Primer PCR Length: 2103. Estimated Deletion Size: about 1800 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00061616 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00031908 Copy
http://www.wormbase.org/db/get?name=WBStrain00031904
Source Database: WormBase (WB)
Affected Genes: WBGene00020398(cerk-1)
Genomic Alteration: WBGene00020398(cerk-1)
Availability: available
Source References: EMPTY
Synonyms: T10B11.2(ok1252) I.
Alternate IDs: WB-STRAIN:RB1203, CGC_RB1203
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T10B11.2 Homozygous. Outer Left Sequence: GGTTCGGCAAAGCACATAAT. Outer Right Sequence: TAACAACGGCATTGAATGGA. Inner Left Sequence: TCATTCCGACGGTACCATTT. Inner Right Sequence: TGAAGCTTGAAATGCAGTGG. Inner Primer PCR Length: 2465. Estimated Deletion Size: about 1300 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031904 Copy
http://www.wormbase.org/db/get?name=WBStrain00031903
Source Database: WormBase (WB)
Affected Genes: WBGene00013955(kri-1)
Genomic Alteration: WBGene00013955(kri-1)
Availability: available
Source References: EMPTY
Synonyms: ZK265.1(ok1251) I.
Alternate IDs: WB-STRAIN:RB1202, CGC_RB1202
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK265.1 Homozygous. Outer Left Sequence: ttgctcaacatcatgcccta. Outer Right Sequence: aatggcggaagtatctgtgg. Inner Left Sequence: tcgaaaatcccaattcaacc. Inner Right Sequence: gagccgatgttttcaagctc. Inner Primer PCR Length: 2972. Estimated Deletion Size: about 1400 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00031903 Copy
http://www.wormbase.org/db/get?name=WBStrain00031913
Source Database: WormBase (WB)
Affected Genes: WBGene00019485(K07D4.5)
Genomic Alteration: WBGene00019485(K07D4.5)
Availability: available
Source References: EMPTY
Synonyms: K07D4.5(ok1268) II.
Alternate IDs: WB-STRAIN:RB1212, CGC_RB1212
Notes: K07D4.5 Homozygous. Outer Left Sequence: caggaagaggggaaacatca. Outer Right Sequence: ttttgggaggcatgaatagg. Inner Left Sequence: gggtacatccattgccattc. Inner Right Sequence: gcacccgacattttcagttt. Inner Primer PCR Length: 3286. Estimated Deletion Size: about 1800 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031913 Copy
http://www.wormbase.org/db/get?name=WBStrain00031912
Source Database: WormBase (WB)
Affected Genes: WBGene00016421(cdc-7)
Genomic Alteration: WBGene00016421(cdc-7)
Availability: available
Source References: EMPTY
Synonyms: C34G6.5(ok1267) I.
Alternate IDs: WB-STRAIN:RB1211, CGC_RB1211
Notes: C34G6.5 Homozygous. Outer Left Sequence: ccgtatcacacactcatcgg. Outer Right Sequence: attgctaaaacccgcagaaa. Inner Left Sequence: agaaggacaactggctccaa. Inner Right Sequence: caacacagcaagcgagaaaa. Inner Primer PCR Length: 2678. Estimated Deletion Size: about 1400 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031912 Copy
http://www.wormbase.org/db/get?name=WBStrain00031999
Source Database: WormBase (WB)
Affected Genes: WBGene00000383(cdc-14)
Genomic Alteration: WBGene00000383(cdc-14)
Availability: available
Source References: EMPTY
Synonyms: cdc-14(ok1407) II.
Alternate IDs: WB-STRAIN:RB1300, CGC_RB1300
Notes: C17G10.4 Homozygous. Outer Left Sequence: cagtcgtggatgaacactcg. Outer Right Sequence: caccacaaatgactgttccg. Inner Left Sequence: gagacacttttctcggacgg. Inner Right Sequence: tgaatcgaaatcgtgaacca. Inner Primer PCR Length: 3306. Estimated Deletion Size: about 1200 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031999 Copy
http://www.wormbase.org/db/get?name=WBStrain00031910
Source Database: WormBase (WB)
Affected Genes: WBGene00000264(brc-1)
Genomic Alteration: WBGene00000264(brc-1)
Availability: available
Source References: EMPTY
Synonyms: brc-1(ok1261) III.
Alternate IDs: WB-STRAIN:RB1209, CGC_RB1209
Notes: C36A4.8 Homozygous. Outer Left Sequence: aagccaatgaactggtggtc. Outer Right Sequence: tttgtgtgcaaacaccgatt. Inner Left Sequence: gttgagaccgcagaaatcgt. Inner Right Sequence: caaaccgacacaaaatcacg. Inner Primer PCR Length: 2392. Estimated Deletion Size: about 1600 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031910 Copy
http://www.wormbase.org/db/get?name=WBStrain00031998
Source Database: WormBase (WB)
Affected Genes: WBGene00016078(C24H12.9)
Genomic Alteration: WBGene00016078(C24H12.9)
Availability: available
Source References: EMPTY
Synonyms: C24H12.9(ok1406) II.
Alternate IDs: WB-STRAIN:RB1299, CGC_RB1299
Notes: C24H12.9 Homozygous. Outer Left Sequence: tcaattccttgtttttgggc. Outer Right Sequence: gtcttgctcgcctctttctg. Inner Left Sequence: gtgcctccaaattacgcact. Inner Right Sequence: atcatccgagatccatttgc. Inner Primer PCR Length: 2113. Estimated Deletion Size: about 1200 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031998 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within Kravitz that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
