Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00062576
Source Database: WormBase (WB)
Affected Genes: WBGene00003271(mir-43)
Genomic Alteration: WBGene00003271(mir-43)
Availability: unknown
Source References: EMPTY
Synonyms: mir-43(sjm1) II.
Notes: Homozygotes lack obvious gross phenotypes; miR-43(sjm1) accumulates in L4 larvae compared to wild-type miR-43. mir-43(sjm1) has an inversion of the miR-43 seed sequence. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.|"Made_by: Michael Stubna"
Proper citation: RRID:WB-STRAIN:WBStrain00062576 Copy
http://www.wormbase.org/db/get?name=WBStrain00062577
Source Database: WormBase (WB)
Affected Genes: WBGene00003271(mir-43)
Genomic Alteration: WBGene00003271(mir-43)
Availability: unknown
Source References: EMPTY
Synonyms: mir-43(sjm2) II.
Notes: Homozygotes lack obvious gross phenotypes. mir-43(sjm2) has positions 9-23 of miR-43 substituted for random sequence. This strain is also homozygous for a G>T point substitution at position 8 of miR-42. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.|"Made_by: Michael Stubna"
Proper citation: RRID:WB-STRAIN:WBStrain00062577 Copy
http://www.wormbase.org/db/get?name=WBStrain00062610
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Caenorhabditis sp. 78 wild isolate.
Notes: Made_by: Marie-Anne Felix and Hagus Tarno's lab|"Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting flowers of Stewartia pseudocamellia collected near Malino, South Sulawesi, Indonesia, on 6 May 2024. GPS -5.242944, 119.868592. Reference: Devi, et al., in preparation."
Proper citation: RRID:WB-STRAIN:WBStrain00062610 Copy
http://www.wormbase.org/db/get?name=WBStrain00062613
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Caenorhabditis sp. 80 wild isolate.
Notes: Made_by: Marie-Anne Felix and Hagus Tarno's lab|"Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting wild Musa pseudostems collected in the forest on the road between Bromo and Malang, East Java, Indonesia, on 11 May 2024. GPS -7.99746, 112.87387. Reference: Devi, et al., in preparation."
Proper citation: RRID:WB-STRAIN:WBStrain00062613 Copy
http://www.wormbase.org/db/get?name=WBStrain00062614
Source Database: WormBase (WB)
Affected Genes: WBGene00003625(nhr-31)
Genomic Alteration: WBGene00003625(nhr-31)
Availability: unknown
Source References: EMPTY
Synonyms: nhr-31(ye123) IV.
Notes: Made_by: Youmie Kim|"Maintain at 15C. Temperature-sensitive: slow growth rate, reduced brood size. Resistant to Cry proteins. Isolated from EMS screen in N2 background. Reference: Kim YM, et al. PLoS Pathog. 2024 Oct 18;20(10):e1012611. doi: 10.1371/journal.ppat.1012611. PMID: 39423230."
Proper citation: RRID:WB-STRAIN:WBStrain00062614 Copy
http://www.wormbase.org/db/get?name=WBStrain00062579
Source Database: WormBase (WB)
Affected Genes: WBGene00003271(mir-43)|WBGene00004140(ebax-1)
Genomic Alteration: WBGene00003271(mir-43), WBGene00004140(ebax-1)
Availability: unknown
Source References: EMPTY
Synonyms: mir-43(sjm1) II; ebax-1(tm2321) IV.
Notes: Homozygotes lack obvious gross phenotypes, though some miRNAs are elevated due to a loss-of-function mutation in ebax-1. mir-43(sjm1) is an inversion of the seed sequence of miR-43. Generated by mating parental strain CZ9907 hermaphrodites to mir-43(sjm1) males. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.|"Made_by: Michael Stubna"
Proper citation: RRID:WB-STRAIN:WBStrain00062579 Copy
http://www.wormbase.org/db/get?name=WBStrain00062607
Source Database: WormBase (WB)
Affected Genes: WBGene00006514(tdp-1)
Genomic Alteration: WBGene00006514(tdp-1)
Availability: unknown
Source References: EMPTY
Synonyms: tdp-1(tgx58) I.
Notes: Made_by: nVivo Biosystems/ Nemametrix and Hart lab|"Null allele. CRISPR-engineered deletion of the tdp-1 locus precisely eliminates all known tdp-1 exons and introns. Reference: Lins J, et al. Generation of a C. elegans tdp-1 null allele and humanized TARDBP containing human disease-variants. MicroPubl Biol. 2023 Jun 6;2023:10.17912/micropub.biology.000693. doi: 10.17912/micropub.biology.000693. PMID: 37351305."
Proper citation: RRID:WB-STRAIN:WBStrain00062607 Copy
http://www.wormbase.org/db/get?name=WBStrain00062604
Source Database: WormBase (WB)
Affected Genes: WBGene00001975(hmg-5)
Genomic Alteration: WBGene00001975(hmg-5)
Availability: unknown
Source References: EMPTY
Synonyms: hmg-5(xn107[hmg-5::gfp]) IV.
Notes: GFP-tagged HMG-5/TFAM labels mtDNA nucleoids. GFP tag causes a reduction in number of mtDNAs. Reference: Schwartz AZA, et al. eLife. 2022 Oct 6:11:e80396. doi: 10.7554/eLife.80396. PMID: 36200990.|"Made_by: Aaron Schwartz"
Proper citation: RRID:WB-STRAIN:WBStrain00062604 Copy
http://www.wormbase.org/db/get?name=WBStrain00062608
Source Database: WormBase (WB)
Affected Genes: WBGene00008266(rike-1)
Genomic Alteration: WBGene00008266(rike-1)
Availability: unknown
Source References: EMPTY
Synonyms: rike-1(syb1165) V/nT1[qIs51] (IV;V).
Notes: Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP rike-1(syb1165) homozygotes (early larval lethality). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Cheng X, et al. Autophagy. 2023 Jan;19(1):241-255. doi: 10.1080/15548627.2022.2071381. PMID: 35521960.|"Made_by: SunyBiotech"
Proper citation: RRID:WB-STRAIN:WBStrain00062608 Copy
http://www.wormbase.org/db/get?name=WBStrain00062609
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Caenorhabditis sp. 77 wild isolate.
Notes: Made_by: Marie-Anne Felix and Hagus Tarno's lab|"Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting banana flowers collected in a forest near Batu, East Java, Indonesia, on 28 Apr 2024. GPS -7.803387, 112.516604. Reference: Devi, et al., in preparation."
Proper citation: RRID:WB-STRAIN:WBStrain00062609 Copy
http://www.wormbase.org/db/get?name=WBStrain00062562
Source Database: WormBase (WB)
Affected Genes: WBGene00019322(ahcy-1)
Genomic Alteration: WBGene00019322(ahcy-1)
Availability: unknown
Source References: EMPTY
Synonyms: ahcy-1(syb748) I.
Notes: ahcy-1(syb748) is a CRISPR/Cas9-engineered C280A substitution that eliminates electrophile sensing but retains enzymatic activity.|"Made_by: SunyBiotech Co., Ltd"
Proper citation: RRID:WB-STRAIN:WBStrain00062562 Copy
http://www.wormbase.org/db/get?name=WBStrain00062566
Source Database: WormBase (WB)
Affected Genes: WBGene00000601(col-12)
Genomic Alteration: WBGene00000601(col-12)
Availability: unknown
Source References: EMPTY
Synonyms: col-12::mNG(ju1932) V.
Notes: Made_by: Jennifer Gotenstein Adams|"mNG inserted at C-terminus of endogenous col-12 locus."
Proper citation: RRID:WB-STRAIN:WBStrain00062566 Copy
http://www.wormbase.org/db/get?name=WBStrain00062603
Source Database: WormBase (WB)
Affected Genes: WBGene00003004(lin-15)
Genomic Alteration: WBGene00003004(lin-15)
Availability: unknown
Source References: EMPTY
Synonyms: lin-15AB(n765) X; wzIs20.
Notes: wzIs20 [lgc-55p::GFP + lin-15(+)]. lgc-55 regulatory sequences drive expression of GFP in neurons, GLR cells and some muscles. Reference: Ringstad N, et al. Science. 2009;325(5936):96-100. doi:10.1126/science.1169243
Proper citation: RRID:WB-STRAIN:WBStrain00062603 Copy
http://www.wormbase.org/db/get?name=WBStrain00062601
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00020142(aak-2)
Genomic Alteration: WBGene00006843(unc-119), WBGene00020142(aak-2)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3) III; aak-2(ok524) X; fphIs3.
Notes: fphIs3 [rab-3p::aak-2A::GFP + unc-119(+)]. aak-2A isoform expressed from the neuronal rab-3 promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.
Proper citation: RRID:WB-STRAIN:WBStrain00062601 Copy
http://www.wormbase.org/db/get?name=WBStrain00062551
Source Database: WormBase (WB)
Affected Genes: WBGene00006687(twk-35)
Genomic Alteration: WBGene00006687(twk-35)
Availability: unknown
Source References: EMPTY
Synonyms: twk-35(mac531) V.
Notes: Made_by: Chuanman Zhou|"twk-35 loss-of-function allele. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723."
Proper citation: RRID:WB-STRAIN:WBStrain00062551 Copy
http://www.wormbase.org/db/get?name=WBStrain00062555
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: rexEx7.
Notes: Made_by: SunyBiotech Co., Ltd|"rexEx7 [gpa-4p::gfp::halo + mec-7p::mRFP]. Pick fluorescent worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Green fluorescence in two ASI neurons."
Proper citation: RRID:WB-STRAIN:WBStrain00062555 Copy
http://www.wormbase.org/db/get?name=WBStrain00062559
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: dvIs19 III; rexEx11.
Notes: dvIs19 [gst-4p::GFP::NLS] III. rexEx11 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of Halo::TEV::Keap1 protein. Oxidative stress induces expression of GFP. Superficially wild-type.|"Made_by: Marcus J. C. Long"
Proper citation: RRID:WB-STRAIN:WBStrain00062559 Copy
http://www.wormbase.org/db/get?name=WBStrain00062705
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: qSi423 II.
Notes: qSi423 [gld-1p::GFP::H2B::gld-1 3'UTR(FBEa TGT to ACA & FBEa* TGT to ACA)[*rajSi50] + Cbr-unc-119(+)] II. Modification of gld-1 FBEa and FBEa* in gld-1 3'UTR of single-copy insertion transgene. Qiu et al., in preparation.
Proper citation: RRID:WB-STRAIN:WBStrain00062705 Copy
http://www.wormbase.org/db/get?name=WBStrain00062706
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: rajSi50 II; unc-119(ed3) III.
Notes: Made_by: Kathrin Theil|"rajSi50 [gld-1p::GFP::H2B::gld-1 3'UTR + Cbr-unc-119(+)] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. GFP is visible in germline nuclei, low in distal germ cells, increases proximally, strong in oocytes. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa: slc314 GTCACCAAGTACACTTCCAGCAAG / slc311 TGGCAACATGATGTATGGCACA (100 bp band in FBEa wt). FBEb: slc314 GTCACCAAGTACACTTCCAGCAAG / slc304 GGGTTAGCGTTAAGATAACACA (~500 bp band in FBEb wt). References: Theil K, et al. Nature Commun. 2019 Sep 16;10(1):4205. doi: 10.1038/s41467-019-12050-7. PMID: 31527589. Carrick BH, et al. Dev Cell. 2024. PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
Proper citation: RRID:WB-STRAIN:WBStrain00062706 Copy
http://www.wormbase.org/db/get?name=WBStrain00062704
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00001401(fbf-1)|WBGene00001402(fbf-2)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001401(fbf-1), WBGene00001402(fbf-2)
Availability: unknown
Source References: EMPTY
Synonyms: fbf-1(ok91) fbf-2(q1291[*q973])/mIn1 [mIs14 dpy-10(e128)] II.
Notes: Made_by: Brian Carrick|"Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered Y479E substitution. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain."
Proper citation: RRID:WB-STRAIN:WBStrain00062704 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within Kravitz that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.