Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
OG474 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029260 | Caenorhabditis elegans | drSi4 II; unc-119(ed3) III. | drSi4 [vha-6p::3XFLAG::pgp-3/CFTR(delta F508)::mCherry::unc-54 3'UTR] II. Superficially wild-type with mCherry expression only in the intestine with significantly diminished expression as compared to drSi2. Single copy integration of the vha-6 promoter driving the PGP-3 protein with an N-terminal 3XFLAG tag and a C-terminal mCherry tag. Amino acids 476-484 of PGP-3 have been replaced with amino acids 501-509 of human CFTR with F508 deleted (TIKENII_G). Transgene was inserted at the ttTi5605 locus on LGII and verified to be a single copy insertion by long range PCR across the genomic locus. Reference: He L, et al. Dis Model Mech. 2012 Nov;5(6):930-9. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00029260 | WormBase (WB) | WB | available | WB-STRAIN:OG474, CGC_OG474 | 2026-09-12 11:15:55 | 0 | |||
|
OE3063 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029254 | Caenorhabditis elegans | daf-19(m86) II. | Daf-c. Dyf. Maintain at 15C. | WBGene00000914(daf-19) | WBGene00000914(daf-19) | WB-STRAIN:WBStrain00029254 | WormBase (WB) | WB | available | WB-STRAIN:OE3063, CGC_OE3063 | 2026-09-12 11:15:55 | 0 | |||
|
OEB730 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029255 | Caenorhabditis elegans | oqEx500. | oqEx500 [tmem-107::GFP + unc-122p::DsRed]. Pick DsRed+ animals to maintain. TMEM-107::GFP accumulates in the ciliary transition zones of ciliated neurons. Reference: Lambacher NJ, et al. Nat Cell Biol. 2016 Jan;18(1):122-31. | WB-STRAIN:WBStrain00029255 | WormBase (WB) | WB | available | WB-STRAIN:OEB730, CGC_OEB730 | 2026-09-12 11:15:55 | 0 | |||||
|
OEB800 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029256 | Caenorhabditis elegans | tmem-107(oq100) I. | F39B2.9/TMEM-107 has been shown to control the localization of 4 peripheral ciliary transition zone proteins. tmem-107(oq100); nphp-4(tm925) double mutants display ultra-structural malformations in ciliary transition zones, and exhibit sensory abnormalities including roaming, chemoattractant, and dye-filling defects. TRAM-1::tdTomato leaks into cilia in oq100 mutants. Genotyping primers: Forward cgcggttcttcttgtttctt, Reverse wildtype gagatcgagacggcgacg, Reverse oq100 gaaaaacaacgtggaagtcca. Reference: Lambacher NJ, et al. Nat Cell Biol. 2016 Jan;18(1):122-31. | WBGene00043308(tmem-107) | WBGene00043308(tmem-107) | WB-STRAIN:WBStrain00029256 | WormBase (WB) | WB | available | WB-STRAIN:OEB800, CGC_OEB800 | 2026-09-12 11:15:55 | 0 | |||
|
OG153 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029257 | Caenorhabditis elegans | unc-119(ed3) III; drEx206. | drEx206 [hsf-1p::hsf-1::YFP::unc-54 3'UTR + unc-119(+)]. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00029257 | WormBase (WB) | WB | available | WB-STRAIN:OG153, CGC_OG153 | 2026-09-12 11:15:55 | 0 | |||
|
OE3010 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029251 | Caenorhabditis elegans | lin-15B&lin-15A(n765) X; ofEx4. | Made_by: A. Miranda Vizuete|"ofEx4 [trx-1::GFP + lin-15(+)]. Animals with the array are non-Muv. Animals which have lost the array are Muv. lin-15(n765) is temperature sensitive. GFP expression in ASJ neurons and to some extent in posterior-most intestinal cells." | WBGene00023497(lin-15B)|WBGene00023498(lin-15A) | WBGene00023497(lin-15B), WBGene00023498(lin-15A) | WB-STRAIN:WBStrain00029251 | WormBase (WB) | WB | available | WB-STRAIN:OE3010, CGC_OE3010 | 2026-09-12 11:15:55 | 0 | |||
|
OE3001 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029247 | Caenorhabditis elegans | him-8(e1489) IV; dyf-4(m158) V. | Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective. Throws males. | WBGene00001867(him-8)|WBGene00007552(dyf-4) | WBGene00001867(him-8), WBGene00007552(dyf-4) | WB-STRAIN:WBStrain00029247 | WormBase (WB) | WB | available | WB-STRAIN:OE3001, CGC_OE3001 | 2026-09-12 11:15:55 | 0 | |||
|
OE3003 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029249 | Caenorhabditis elegans | xbx-4(ok635) IV. | Mutagen:UV/TMP|"No obvious phenotype." | WBGene00016025(xbx-4) | WBGene00016025(xbx-4) | WB-STRAIN:WBStrain00029249 | WormBase (WB) | WB | available | WB-STRAIN:OE3003, CGC_OE3003 | 2026-09-12 11:15:55 | 0 | |||
|
OH1422 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029320 | Caenorhabditis elegans | otIs138 X. | Made_by: Reenal/Adam|"otIs138 [ser-2(prom3)::GFP + rol-6(su1006)] X. Integrated array derived from otEx449." | WB-STRAIN:WBStrain00029320 | WormBase (WB) | WB | available | WB-STRAIN:OH1422, CGC_OH1422 | 2026-09-12 11:15:56 | 0 | |||||
|
OH1571 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029323 | Caenorhabditis elegans | tax-2(ot25) otIs114 I; him-5(e1490) V. | otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic lim-6 expression in a set of cells anterior to ASE. Molecular identity: W40Stop. Null allele. | WBGene00001864(him-5)|WBGene00002988(lim-6)|WBGene00006525(tax-2) | WBGene00001864(him-5), WBGene00002988(lim-6), WBGene00006525(tax-2) | WB-STRAIN:WBStrain00029323 | WormBase (WB) | WB | available | WB-STRAIN:OH1571, CGC_OH1571 | 2026-09-12 11:15:56 | 0 | |||
|
OH1358 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029317 | Caenorhabditis elegans | kyIs123. | kyIs123 [trp-1::GFP]. | WB-STRAIN:WBStrain00029317 | WormBase (WB) | WB | available | WB-STRAIN:OH1358, CGC_OH1358 | 2026-09-12 11:15:56 | 0 | |||||
|
OH1360 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029318 | Caenorhabditis elegans | bgIs312; otEx718. | bgIs312 [pes-6::GFP]. GFP expression in excretory cell only. otEx718 [exc-4p::exc-4::DsRed2 + rol-6(su1006)]. Maintain by picking Rollers. Roller phenotype most penetrant at 20C.|"Made_by: Katie Chi" | WBGene00004777(ser-2)|WBGene00006917(vha-8) | WBGene00004777(ser-2), WBGene00006917(vha-8) | WB-STRAIN:WBStrain00029318 | WormBase (WB) | WB | available | WB-STRAIN:OH1360, CGC_OH1360 | 2026-09-12 11:15:56 | 0 | |||
|
OH1421 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00029319 | Caenorhabditis elegans | hst-6(ok273) X. | Made_by: H Buelow|"Phenotypically WT. In hst-6(ok273) , 1064 nt are deleted following position 39378 in Y34B4A (ACC# AC024755) and replaced by four nucleotides CTTT." | WBGene00002031(hst-6) | WBGene00002031(hst-6) | WB-STRAIN:WBStrain00029319 | WormBase (WB) | WB | available | WB-STRAIN:OH1421, CGC_OH1421 | 2026-09-12 11:15:56 | 3 | |||
|
OH1098 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029313 | Caenorhabditis elegans | otIs133 II. | Made_by: AS Wenick & O Hobert|"otIs133[pttx-3::RFP + unc-4(+)]. RFP expressed in AIY only." | WBGene00006654(ttx-3) | WBGene00006654(ttx-3) | WB-STRAIN:WBStrain00029313 | WormBase (WB) | WB | available | WB-STRAIN:OH1098, CGC_OH1098 | 2026-09-12 11:15:55 | 0 | |||
|
OH1277 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029314 | Caenorhabditis elegans | otEx669. | Made_by: K.L. Berry|"otEx669 [exc-4p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Transcriptional GFP fusion expresses in the excretory cell, excretory pore cell, excretory duct cell, rectal gland cell, hypodermis, seam cells, innerlabial sheath cells, and phasmid sheath cells." | WB-STRAIN:WBStrain00029314 | WormBase (WB) | WB | available | WB-STRAIN:OH1277, CGC_OH1277 | 2026-09-12 11:15:55 | 0 | |||||
|
OH3972 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029397 | Caenorhabditis elegans | otIs151; otEx2310. | Made_by: Chris Ortiz|"otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2310 [gcy-19(prom1)::GFP + unc-122::GFP]. Expresses GFP in IL2, faint in ASEL/R, and faint pairs in head. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+." | WBGene00000457(ceh-36)|WBGene00001544(gcy-19) | WBGene00000457(ceh-36), WBGene00001544(gcy-19) | WB-STRAIN:WBStrain00029397 | WormBase (WB) | WB | available | WB-STRAIN:OH3972, CGC_OH3972 | 2026-09-12 11:15:57 | 0 | |||
|
OH3976 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029398 | Caenorhabditis elegans | otIs151; otEx2314. | Made_by: Chris Ortiz|"otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2314 [gcy-2(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASI, RIA, PVT and AWA. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+." | WBGene00000457(ceh-36)|WBGene00001529(gcy-2) | WBGene00000457(ceh-36), WBGene00001529(gcy-2) | WB-STRAIN:WBStrain00029398 | WormBase (WB) | WB | available | WB-STRAIN:OH3976, CGC_OH3976 | 2026-09-12 11:15:57 | 0 | |||
|
OH1078 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029311 | Caenorhabditis elegans | ttx-3(ot22) X; otEx621. | otEx621 [(pAIY-MCS) ttx-3(cDNA) + unc-47(long)::GFP]. Maintain by picking GFP+.|"otEx621[pAIY-MCS::ttx-3 cDNA, unc-47(long)::GFP]. Maintain by picking GFP+." | WBGene00006654(ttx-3) | WBGene00006654(ttx-3) | WB-STRAIN:WBStrain00029311 | WormBase (WB) | WB | available | WB-STRAIN:OH1078, CGC_OH1078 | 2026-09-12 11:15:55 | 0 | |||
|
OH3992 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029399 | Caenorhabditis elegans | otIs151; otEx2322. | Made_by: Chris Ortiz|"otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2322[gcy-14(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASEL, and dim GFP in ASER and AWC. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+." | WBGene00000457(ceh-36)|WBGene00001540(gcy-14) | WBGene00000457(ceh-36), WBGene00001540(gcy-14) | WB-STRAIN:WBStrain00029399 | WormBase (WB) | WB | available | WB-STRAIN:OH3992, CGC_OH3992 | 2026-09-12 11:15:57 | 0 | |||
|
OH1092 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029312 | Caenorhabditis elegans | otIs131. | otIs131 [gcy-7::RFP + rol-6(su1006)]. Rollers. | WBGene00001534(gcy-7) | WBGene00001534(gcy-7) | WB-STRAIN:WBStrain00029312 | WormBase (WB) | WB | available | WB-STRAIN:OH1092, CGC_OH1092 | 2026-09-12 11:15:55 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
