Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00040875
Source Database: WormBase (WB)
Affected Genes: WBGene00004319(rbr-2)
Genomic Alteration: WBGene00004319(rbr-2)
Availability: available
Source References: EMPTY
Synonyms: rbr-2(tm1231) IV.
Alternate IDs: WB-STRAIN:ZR1, CGC_ZR1
Notes: 648 bp deletion (confirmed). About 80% of animals show defects in vulval development (Muv or Vul).
Proper citation: RRID:WB-STRAIN:WBStrain00040875 Copy
http://www.wormbase.org/db/get?name=WBStrain00040878
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00008400(drh-3)
Genomic Alteration: WBGene00000254(bli-4), WBGene00008400(drh-3)
Availability: available
Source References: EMPTY
Synonyms: drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:ZT2, CGC_ZT2
Notes: Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable.|"Made_by: Moriguchi/Kuroki"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00040878 Copy
http://www.wormbase.org/db/get?name=WBStrain00040877
Source Database: WormBase (WB)
Affected Genes: WBGene00003473(mtl-1)|WBGene00003474(mtl-2)
Genomic Alteration: WBGene00003473(mtl-1), WBGene00003474(mtl-2)
Availability: unknown
Source References: PMID:17141712, PMID:38374083
Synonyms: mtl-1(tm1770) mtl-2(gk125) V.
Alternate IDs: WB-STRAIN:ZS1
Notes: This strain is described as zs1. It should be ZS1
Proper citation: RRID:WB-STRAIN:WBStrain00040877 Copy
http://www.wormbase.org/db/get?name=WBStrain00040871
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: available
Source References: EMPTY
Synonyms: daf-2(m596) III; hpEx2905.
Alternate IDs: WB-STRAIN:ZM9028, CGC_ZM9028
Notes: hpEx2905 [myo-2p::RFP + myo-3p::daf-2]. Pick RFP+ to maintain. Maintain at 15C. Temperature sensitive dauer constitutive. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
Proper citation: RRID:WB-STRAIN:WBStrain00040871 Copy
http://www.wormbase.org/db/get?name=WBStrain00040806
Source Database: WormBase (WB)
Affected Genes: WBGene00006575(tir-1)
Genomic Alteration: WBGene00006575(tir-1)
Availability: available
Source References: PMID:37122724, PMID:38232128
Synonyms: tir-1(qd4) III.
Alternate IDs: WB-STRAIN:ZD101, CGC_ZD101
Notes: Enhanced pathogen susceptibility. Egg laying in response to food is defective. Reference: Shivers RP et al., (2009) Cell Host Microbe 6:321-30.
Proper citation: RRID:WB-STRAIN:WBStrain00040806 Copy
http://www.wormbase.org/db/get?name=WBStrain00040809
Source Database: WormBase (WB)
Affected Genes: WBGene00004758(sek-1)
Genomic Alteration: WBGene00004758(sek-1)
Availability: available
Source References: EMPTY
Synonyms: sek-1(km4) X; qdEx11.
Alternate IDs: WB-STRAIN:ZD260, CGC_ZD260
Notes: no longer available from the CGC.|"qdEx11 [osm-5p::sek-1(cDNA)::GFP::unc-54-3' UTR + myo-2p::mStrawberry::unc-54-3' UTR]. Array rescues sek-1 in ciliated sensory neurons. References: Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30."
Proper citation: RRID:WB-STRAIN:WBStrain00040809 Copy
http://www.wormbase.org/db/get?name=WBStrain00040808
Source Database: WormBase (WB)
Affected Genes: WBGene00004758(sek-1)
Genomic Alteration: WBGene00004758(sek-1)
Availability: available
Source References: EMPTY
Synonyms: sek-1(km4) X; qdEx8.
Alternate IDs: WB-STRAIN:ZD202, CGC_ZD202
Notes: qdEx8 [unc-119p::sek-1(cDNA)::GFP::unc-54-3' UTR + myo-2p::mStrawberry::unc-54-3' UTR]. Array rescues sek-1 in neurons. References: Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.
Proper citation: RRID:WB-STRAIN:WBStrain00040808 Copy
http://www.wormbase.org/db/get?name=WBStrain00040802
Source Database: WormBase (WB)
Affected Genes: WBGene00021316(Y32H12A.8)
Genomic Alteration: WBGene00021316(Y32H12A.8)
Availability: available
Source References: EMPTY
Synonyms: Y32H12A.8(tm419) III.
Alternate IDs: WB-STRAIN:ZB2774, CGC_ZB2774
Notes: Made_by:
Proper citation: RRID:WB-STRAIN:WBStrain00040802 Copy
http://www.wormbase.org/db/get?name=WBStrain00040881
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: zwIs106.
Alternate IDs: WB-STRAIN:ZW127, CGC_ZW127
Notes: zwIs106 contains [unc-9p::GFP + lin-15(+)]. Superficially wild-type. Maintain under normal conditions. Described in Altun et al. Dev Dyn 238:1936-50 (2009).
Proper citation: RRID:WB-STRAIN:WBStrain00040881 Copy
http://www.wormbase.org/db/get?name=WBStrain00040886
Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: EMPTY
Synonyms: lin-15B&lin-15A(n765) X; zwEx104.
Alternate IDs: WB-STRAIN:ZW284, CGC_ZW284
Notes: zwEx104 [inx-4p::GFP + lin-15(+)]. Pick non-Muv to maintain. Maintain under normal conditions. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
Proper citation: RRID:WB-STRAIN:WBStrain00040886 Copy
http://www.wormbase.org/db/get?name=WBStrain00040883
Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: EMPTY
Synonyms: lin-15B&lin-15A(n765) X; zwEx101.
Alternate IDs: WB-STRAIN:ZW281, CGC_ZW281
Notes: zwEx101 [inx-1p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
Proper citation: RRID:WB-STRAIN:WBStrain00040883 Copy
http://www.wormbase.org/db/get?name=WBStrain00040884
Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: EMPTY
Synonyms: lin-15B&lin-15A(n765) X; zwEx102.
Alternate IDs: WB-STRAIN:ZW282, CGC_ZW282
Notes: zwEx102 [inx-2p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
Proper citation: RRID:WB-STRAIN:WBStrain00040884 Copy
http://www.wormbase.org/db/get?name=WBStrain00040858
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: available
Source References: EMPTY
Synonyms: daf-2(e1370) III; oxIs22.
Alternate IDs: WB-STRAIN:ZM4864, CGC_ZM4864
Notes: oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
Proper citation: RRID:WB-STRAIN:WBStrain00040858 Copy
http://www.wormbase.org/db/get?name=WBStrain00040857
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: hpIs166.
Alternate IDs: WB-STRAIN:ZM4624, CGC_ZM4624
Notes: hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. Reference: Gao S, et al. 2015. Nature Communications 6, Article number: 6323.
Proper citation: RRID:WB-STRAIN:WBStrain00040857 Copy
http://www.wormbase.org/db/get?name=WBStrain00040855
Source Database: WormBase (WB)
Affected Genes: WBGene00003558(nca-2)|WBGene00006809(unc-77)
Genomic Alteration: WBGene00003558(nca-2), WBGene00006809(unc-77)
Availability: available
Source References: EMPTY
Synonyms: nca-2(gk5) III; unc-77(gk9) IV.
Alternate IDs: WB-STRAIN:ZM2960, CGC_ZM2960
Notes: Uncoordinated behaviour. Fainter, pauses quickly after stimulating touch-response by prodding or tapping plate. References: Humphry JA, et al. Curr Biol. 2007 Apr 3;17(7):624-9. Gao S, et al. Nat Commun. 2015 Feb 26;6:6323.
Proper citation: RRID:WB-STRAIN:WBStrain00040855 Copy
http://www.wormbase.org/db/get?name=WBStrain00040850
Source Database: WormBase (WB)
Affected Genes: WBGene00006364(syd-2)
Genomic Alteration: WBGene00006364(syd-2)
Availability: available
Source References: PMID:33147118
Synonyms: syd-2(ok217) X.
Alternate IDs: WB-STRAIN:ZM607, CGC_ZM607
Notes: Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA).|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00060580 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00040850 Copy
http://www.wormbase.org/db/get?name=WBStrain00040851
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: available
Source References: EMPTY
Synonyms: daf-2(e1370) III; juIs1 IV.
Alternate IDs: WB-STRAIN:ZM1157, CGC_ZM1157
Notes: juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
Proper citation: RRID:WB-STRAIN:WBStrain00040851 Copy
http://www.wormbase.org/db/get?name=WBStrain00040869
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: available
Source References: EMPTY
Synonyms: daf-2(m596) III; hpEx3369.
Alternate IDs: WB-STRAIN:ZM8562, CGC_ZM8562
Notes: hpEx3369 [myo-2p::RFP + ges-1p(short)::daf-2]. Transgenic worms do not dauer. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
Proper citation: RRID:WB-STRAIN:WBStrain00040869 Copy
http://www.wormbase.org/db/get?name=WBStrain00040868
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: available
Source References: EMPTY
Synonyms: daf-2(m596) III; hpEx2906.
Alternate IDs: WB-STRAIN:ZM8561, CGC_ZM8561
Notes: hpEx2906 [myo-2p::RFP + rgef-1p::daf-2]. Transgenic worms dauer easily. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
Proper citation: RRID:WB-STRAIN:WBStrain00040868 Copy
http://www.wormbase.org/db/get?name=WBStrain00040901
Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: EMPTY
Synonyms: lin-15B&lin-15A(n765) X; zwEx119.
Alternate IDs: WB-STRAIN:ZW299, CGC_ZW299
Notes: zwEx119 [inx-19p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
Proper citation: RRID:WB-STRAIN:WBStrain00040901 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within Kravitz that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
