Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00028990
Source Database: WormBase (WB)
Affected Genes: WBGene00004682(rsd-3)
Genomic Alteration: WBGene00004682(rsd-3)
Availability: available
Source References: EMPTY
Synonyms: rsd-3(pk2013) X.
Alternate IDs: WB-STRAIN:NL2013, CGC_NL2013
Notes: mut-6 background|"Resistant to feeding dsRNA."
Proper citation: RRID:WB-STRAIN:WBStrain00028990 Copy
http://www.wormbase.org/db/get?name=WBStrain00028907
Source Database: WormBase (WB)
Affected Genes: WBGene00001079(dpy-20)
Genomic Alteration: WBGene00001079(dpy-20)
Availability: available
Source References: PMID:9203577
Synonyms: dpy-20(e1362) IV; pkIs334.
Alternate IDs: WB-STRAIN:NL557, CGC_NL557
Notes: pkIs334 [gsa-1(+) + dpy-20(+)]. gsa-1 overexpression. The strain is Egl-c and moves actively.
Proper citation: RRID:WB-STRAIN:WBStrain00028907 Copy
http://www.wormbase.org/db/get?name=WBStrain00028908
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:NL581
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00028908 Copy
http://www.wormbase.org/db/get?name=WBStrain00028903
Source Database: WormBase (WB)
Affected Genes: WBGene00001679(gpb-1)
Genomic Alteration: WBGene00001679(gpb-1)
Availability: available
Source References: PMID:8752216
Synonyms: gpb-1(pk44) II; pkEx170.
Alternate IDs: WB-STRAIN:NL361, CGC_NL361
Notes: Made_by: Zwaal and Plasterk|"pkEx170 [(pRP403) gpb-1(+) + (pRF4) rol-6(su1006)]. Rollers. Pick Rollers to maintain. NL361 is homozygous for the gpb-1 deletion allele pk44; this results in an L1 arrest if the larvae has maternally derived GPB-1 or in an early embryonic lethality if there is no maternally derived GPB-1 for the developing embryo. This phenotype is rescued by the extrachromosomal transgene which contains the WT gpb-1 gene."|"pkEx170 [gpb-1(+) + rol-6(su1006)]. Rollers. Pick Rollers to maintain. NL361 is homozygous for the gpb-1 deletion allele pk44; this results in an L1 arrest if the larvae has maternally derived GPB-1 or in an early embryonic lethality if there is no maternally derived GPB-1 for the developing embryo. This phenotype is rescued by the extrachromosomal transgene which contains the WT gpb-1 gene."
Proper citation: RRID:WB-STRAIN:WBStrain00028903 Copy
http://www.wormbase.org/db/get?name=WBStrain00028904
Source Database: WormBase (WB)
Affected Genes: WBGene00002016(hsp-16.2)
Genomic Alteration: WBGene00002016(hsp-16.2)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:NL520
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00028904 Copy
http://www.wormbase.org/db/get?name=WBStrain00028905
Source Database: WormBase (WB)
Affected Genes: WBGene00001745(gsa-1)
Genomic Alteration: WBGene00001745(gsa-1)
Availability: available
Source References: PMID:9203577
Synonyms: gsa-1(pk75) I; pkEx270.
Alternate IDs: WB-STRAIN:NL542, CGC_NL542
Notes: pkEx270 [rol-6(su1006) + gsa-1(+)]. pk75 is an L1 larval lethal. The strain segregates Rollers and L1 lethals.
Proper citation: RRID:WB-STRAIN:WBStrain00028905 Copy
http://www.wormbase.org/db/get?name=WBStrain00028902
Source Database: WormBase (WB)
Affected Genes: WBGene00001664(gpa-2)|WBGene00001665(gpa-3)
Genomic Alteration: WBGene00001664(gpa-2), WBGene00001665(gpa-3)
Availability: available
Source References: PMID:9055081
Synonyms: gpa-2(pk16) gpa-3(pk35) V.
Alternate IDs: WB-STRAIN:NL348, CGC_NL348
Notes: Reduced response to exogenously added dauer pheromone and thus defective in the regulation of dauer formation.
Proper citation: RRID:WB-STRAIN:WBStrain00028902 Copy
http://www.wormbase.org/db/get?name=WBStrain00028983
Source Database: WormBase (WB)
Affected Genes: WBGene00000068(acy-1)|WBGene00001079(dpy-20)|WBGene00002016(hsp-16.2)
Genomic Alteration: WBGene00000068(acy-1), WBGene00001079(dpy-20), WBGene00002016(hsp-16.2)
Availability: available
Source References: EMPTY
Synonyms: acy-1(pk884) III; dpy-20(e1362) IV; pkIs296 X.
Alternate IDs: WB-STRAIN:NL1925, CGC_NL1925
Notes: pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.
Proper citation: RRID:WB-STRAIN:WBStrain00028983 Copy
http://www.wormbase.org/db/get?name=WBStrain00028985
Source Database: WormBase (WB)
Affected Genes: WBGene00000068(acy-1)|WBGene00001076(dpy-17)
Genomic Alteration: WBGene00000068(acy-1), WBGene00001076(dpy-17)
Availability: available
Source References: EMPTY
Synonyms: acy-1(pk1279)/dpy-17(e164) III.
Alternate IDs: WB-STRAIN:NL1999, CGC_NL1999
Notes: Heterozygotes are wild-type and segregate Dpys, wild-type, and arrested larvae that hardly move or pump. Suppressor of activated Gs. sgs-1 also called acy-1.
Proper citation: RRID:WB-STRAIN:WBStrain00028985 Copy
http://www.wormbase.org/db/get?name=WBStrain00028986
Source Database: WormBase (WB)
Affected Genes: WBGene00001680(gpb-2)
Genomic Alteration: WBGene00001680(gpb-2)
Availability: available
Source References: EMPTY
Synonyms: gpb-2(pk751) I.
Alternate IDs: WB-STRAIN:NL2001, CGC_NL2001
Notes: Flanking sequence: AGTCACTCTT - deletion - GAAGACTACT.
Proper citation: RRID:WB-STRAIN:WBStrain00028986 Copy
http://www.wormbase.org/db/get?name=WBStrain00028981
Source Database: WormBase (WB)
Affected Genes: WBGene00000068(acy-1)|WBGene00001079(dpy-20)|WBGene00002016(hsp-16.2)
Genomic Alteration: WBGene00000068(acy-1), WBGene00001079(dpy-20), WBGene00002016(hsp-16.2)
Availability: available
Source References: EMPTY
Synonyms: acy-1(pk867) III; dpy-20(e1362) IV; pkIs296 X.
Alternate IDs: WB-STRAIN:NL1909, CGC_NL1909
Notes: pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.
Proper citation: RRID:WB-STRAIN:WBStrain00028981 Copy
http://www.wormbase.org/db/get?name=WBStrain00028982
Source Database: WormBase (WB)
Affected Genes: WBGene00000068(acy-1)|WBGene00001079(dpy-20)|WBGene00002016(hsp-16.2)
Genomic Alteration: WBGene00000068(acy-1), WBGene00001079(dpy-20), WBGene00002016(hsp-16.2)
Availability: available
Source References: EMPTY
Synonyms: acy-1(pk880) III; dpy-20(e1362) IV; pkIs296 X.
Alternate IDs: WB-STRAIN:NL1921, CGC_NL1921
Notes: pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
Proper citation: RRID:WB-STRAIN:WBStrain00028982 Copy
http://www.wormbase.org/db/get?name=WBStrain00028976
Source Database: WormBase (WB)
Affected Genes: WBGene00020757(ucr-2.3)
Genomic Alteration: WBGene00020757(ucr-2.3)
Availability: available
Source References: EMPTY
Synonyms: T24C4.1(pk732) III.
Alternate IDs: WB-STRAIN:NL1832, CGC_NL1832
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00028976 Copy
http://www.wormbase.org/db/get?name=WBStrain00028977
Source Database: WormBase (WB)
Affected Genes: WBGene00003506(mut-9)
Genomic Alteration: WBGene00003506(mut-9)
Availability: available
Source References: EMPTY
Synonyms: mut-9(pk734)
Alternate IDs: WB-STRAIN:NL1834, CGC_NL1834
Notes: Mutator.
Proper citation: RRID:WB-STRAIN:WBStrain00028977 Copy
http://www.wormbase.org/db/get?name=WBStrain00028978
Source Database: WormBase (WB)
Affected Genes: WBGene00003507(mut-14)
Genomic Alteration: WBGene00003507(mut-14)
Availability: available
Source References: EMPTY
Synonyms: mut-14(pk738)
Alternate IDs: WB-STRAIN:NL1838, CGC_NL1838
Notes: Mutator strain. TS. RNAi defect. TATTCTGGAC A AAGCTGATAA.
Proper citation: RRID:WB-STRAIN:WBStrain00028978 Copy
http://www.wormbase.org/db/get?name=WBStrain00028979
Source Database: WormBase (WB)
Affected Genes: WBGene00011908(pash-1)
Genomic Alteration: WBGene00011908(pash-1)
Availability: available
Source References: EMPTY
Synonyms: pash-1(pk2083)/+ I; pkIs2084.
Alternate IDs: WB-STRAIN:NL1888, CGC_NL1888
Notes: pkIs2084 [col-10::LacZ::lin-41 + goa-1::GFP]. Heterozygous. pash-1(pk2083)/+ heterozygotes look wild-type and will segregate pash-1(pk2083)/+ heterozygotes, sterile pk2083 homozygotes, and wild-type. Pick wild-type heterozygotes and check for segregation of sterile progeny to maintain.
Proper citation: RRID:WB-STRAIN:WBStrain00028979 Copy
http://www.wormbase.org/db/get?name=WBStrain00028975
Source Database: WormBase (WB)
Affected Genes: WBGene00003504(mut-7)
Genomic Alteration: WBGene00003504(mut-7)
Availability: available
Source References: EMPTY
Synonyms: mut-7(pk720) III.
Alternate IDs: WB-STRAIN:NL1820, CGC_NL1820
Notes: Mutator. Flanking sequence: gatttatccattttcaatcca cattttggatggtaaattctca.Mutator.
Proper citation: RRID:WB-STRAIN:WBStrain00028975 Copy
http://www.wormbase.org/db/get?name=WBStrain00028929
Source Database: WormBase (WB)
Affected Genes: WBGene00003185(mek-1)
Genomic Alteration: WBGene00003185(mek-1)
Availability: available
Source References: EMPTY
Synonyms: rde-3(r459) I; mek-1(pk97) X.
Alternate IDs: WB-STRAIN:NL737, CGC_NL737
Notes: K08A8.1 Previously called kin-17(pk97).
Proper citation: RRID:WB-STRAIN:WBStrain00028929 Copy
http://www.wormbase.org/db/get?name=WBStrain00028920
Source Database: WormBase (WB)
Affected Genes: WBGene00004949(sox-2)
Genomic Alteration: WBGene00004949(sox-2)
Availability: available
Source References: EMPTY
Synonyms: rde-3(r459) I; sox-2(pk65).
Alternate IDs: WB-STRAIN:NL713, CGC_NL713
Notes: K08A8.2. Location of the insertion: TCACGTATCT TA CATATTATAT.|"Made_by: M Vroomen"
Proper citation: RRID:WB-STRAIN:WBStrain00028920 Copy
http://www.wormbase.org/db/get?name=WBStrain00028914
Source Database: WormBase (WB)
Affected Genes: WBGene00000939(dcr-1)
Genomic Alteration: WBGene00000939(dcr-1)
Availability: available
Source References: EMPTY
Synonyms: dcr-1(pk1351)/+ III.
Alternate IDs: WB-STRAIN:NL687, CGC_NL687
Notes: Heterozygotes are WT and segregate WT and animals with protruding vulvas (dcr-1 homozygotes).|"Made_by: Fischer/Thijssen"|"Mutagen:UV/TMP"|"no longer available from the CGC."
Proper citation: RRID:WB-STRAIN:WBStrain00028914 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within Kravitz that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.