Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 144 showing 2861 ~ 2880 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00031215

http://www.wormbase.org/db/get?name=WBStrain00031215

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:38564369, PMID:38865452
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:QG2837
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.

Proper citation: RRID:WB-STRAIN:WBStrain00031215 Copy   


  • RRID:WB-STRAIN:WBStrain00031214

http://www.wormbase.org/db/get?name=WBStrain00031214

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:QG2836
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.

Proper citation: RRID:WB-STRAIN:WBStrain00031214 Copy   


  • RRID:WB-STRAIN:WBStrain00031266

http://www.wormbase.org/db/get?name=WBStrain00031266

Source Database: WormBase (WB)
Affected Genes: WBGene00045243(chep-1)
Genomic Alteration: WBGene00045243(chep-1)
Availability: available
Source References: EMPTY
Synonyms: chep-1(qr1).
Alternate IDs: WB-STRAIN:QS1, CGC_QS1
Notes: Weak chemotaxis toward diacetyl. Possibly due to the weak chemotaxis toward diacetyl, qr1 were more preferentialy attracted by sodium acetate than WT in simultaneous two-spot presentation of sodium acetate and diacetyl. Mutagen used was Mos1 transposon, but it is not an insertion allele.

Proper citation: RRID:WB-STRAIN:WBStrain00031266 Copy   


  • RRID:WB-STRAIN:WBStrain00031262

http://www.wormbase.org/db/get?name=WBStrain00031262

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; vhIs24.
Alternate IDs: WB-STRAIN:QR109, CGC_QR109
Notes: vhIs24 [vha-6p::GFP::rab-5 Q78L + Cbr-unc-119(+)]. Large endosomes in the intestinal cells.

Proper citation: RRID:WB-STRAIN:WBStrain00031262 Copy   


  • RRID:WB-STRAIN:WBStrain00031261

http://www.wormbase.org/db/get?name=WBStrain00031261

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; vhIs6.
Alternate IDs: WB-STRAIN:QR47, CGC_QR47
Notes: vhIs6 [vha-6p::mCherry::tbc-2(R689K) + Cbr-unc-119(+)]. mCherry::TBC-2(R689K) is expressed in the intestine.

Proper citation: RRID:WB-STRAIN:WBStrain00031261 Copy   


  • RRID:WB-STRAIN:WBStrain00031268

http://www.wormbase.org/db/get?name=WBStrain00031268

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: izEx5.
Alternate IDs: WB-STRAIN:QU10, CGC_QU10
Notes: izEx5 [lgg-1p::GFP::lgg-1 + odr-1p::RFP]. Pick RFP+/GFP+ animals to maintain. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

Proper citation: RRID:WB-STRAIN:WBStrain00031268 Copy   


  • RRID:WB-STRAIN:WBStrain00031301

http://www.wormbase.org/db/get?name=WBStrain00031301

Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:QX1233, CGC_QX1233
Notes: C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90.

Proper citation: RRID:WB-STRAIN:WBStrain00031301 Copy   


  • RRID:WB-STRAIN:WBStrain00031273

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00031273

Source Database: WormBase (WB)
Affected Genes: WBGene00004804(skn-1)
Genomic Alteration: WBGene00004804(skn-1)
Availability: available
Source References: PMID:32482227, PMID:32535316, PMID:31771413, PMID:33809299, PMID:36791646, PMID:37704756, PMID:38790689
Synonyms: skn-1(zj15) IV.
Alternate IDs: WB-STRAIN:QV225, CGC_QV225
Notes: Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29.|"Reference WBPaper00059755 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype [skn-1(zj15) IV.]"

Proper citation: RRID:WB-STRAIN:WBStrain00031273 Copy   


  • RRID:WB-STRAIN:WBStrain00031272

http://www.wormbase.org/db/get?name=WBStrain00031272

Source Database: WormBase (WB)
Affected Genes: WBGene00004804(skn-1)
Genomic Alteration: WBGene00004804(skn-1)
Availability: available
Source References: EMPTY
Synonyms: dvIs19 III; skn-1(zj15) IV.
Alternate IDs: WB-STRAIN:QV224, CGC_QV224
Notes: dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29.

Proper citation: RRID:WB-STRAIN:WBStrain00031272 Copy   


  • RRID:WB-STRAIN:WBStrain00031279

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00031279

Source Database: WormBase (WB)
Availability: available
Source References: PMID:30078564, PMID:33820969, PMID:37221008, PMID:37572357, PMID:37865119, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:QX1211, CGC_QX1211
Notes: C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90.|"Supplementary_genotype"

Proper citation: RRID:WB-STRAIN:WBStrain00031279 Copy   


  • RRID:WB-STRAIN:WBStrain00031281

http://www.wormbase.org/db/get?name=WBStrain00031281

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:QX1213
Notes: Isolated from soil underneath an orange-half staked out in the backyard of 363 Jersey St. for three days. The soil and orange bits were plated on OP50 on 27 Nov and on 29 Nov six young adult hermaphrodites were detected. Each was singled to found a line, QX1211-1216.

Proper citation: RRID:WB-STRAIN:WBStrain00031281 Copy   


  • RRID:WB-STRAIN:WBStrain00031280

http://www.wormbase.org/db/get?name=WBStrain00031280

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:QX1212
Notes: Isolated from soil underneath an orange-half staked out in the backyard of 363 Jersey St. for three days. The soil and orange bits were plated on OP50 on 27 Nov and on 29 Nov six young adult hermaphrodites were detected. Each was singled to found a line, QX1211-1216.

Proper citation: RRID:WB-STRAIN:WBStrain00031280 Copy   


  • RRID:WB-STRAIN:WBStrain00031364

http://www.wormbase.org/db/get?name=WBStrain00031364

Source Database: WormBase (WB)
Affected Genes: WBGene00016906(C53D5.5)
Genomic Alteration: WBGene00016906(C53D5.5)
Availability: available
Source References: EMPTY
Synonyms: C53D5.5(ok311) I.
Alternate IDs: WB-STRAIN:RB578, CGC_RB578
Notes: C53D5.5. Homozygous. Outer Left Sequence: ccagcttctagccgcataac. Outer Right Sequence: caggtctcgaaacgaccaat. Inner Left Sequence: cccgtttttcagctttgtgt. Inner Right Sequence: acgggcaatattttcggaat. Inner primer WT PCR product: 2904.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00031364 Copy   


  • RRID:WB-STRAIN:WBStrain00031361

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00031361

Source Database: WormBase (WB)
Affected Genes: WBGene00006406(srgp-1)
Genomic Alteration: WBGene00006406(srgp-1)
Availability: available
Source References: EMPTY
Synonyms: srgp-1(ok300) IV.
Alternate IDs: WB-STRAIN:RB570, CGC_RB570
Notes: F12F6.5. Homozygous. Outer Left Sequence: GATGTGAAGGCTGACAAGCA. Outer Right Sequence: TAACCCGTGCATTTGTTGAA. Inner Left Sequence: CTTCGAGGCCAATCATCAAT. Inner Right Sequence: GCCAAAACTATCATGGGCTG. Inner Primer PCR Length: 2904 bp. Deletion Size: 1406 bp. Deletion left flank: ttttattactttgttttatatttcaaaaac. Deletion right flank: atcaagtcgatcttcaaatcgatcaaaagc.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00031361 Copy   


  • RRID:WB-STRAIN:WBStrain00031401

http://www.wormbase.org/db/get?name=WBStrain00031401

Source Database: WormBase (WB)
Affected Genes: WBGene00012379(Y1A5A.1)
Genomic Alteration: WBGene00012379(Y1A5A.1)
Availability: available
Source References: EMPTY
Synonyms: Y1A5A.1(ok414) III.
Alternate IDs: WB-STRAIN:RB661, CGC_RB661
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y1A5A.1. Homozygous. Outer Left Sequence: aggaagcacagactgggaga. Outer Right Sequence: caaatgcttccgtttccatt. Inner Left Sequence: ctgctcgtgtgtgtgtgttg. Inner Right Sequence: tcgtagcattgatcgtcgtc. Inner primer WT PCR product: 2569."

Proper citation: RRID:WB-STRAIN:WBStrain00031401 Copy   


  • RRID:WB-STRAIN:WBStrain00031400

http://www.wormbase.org/db/get?name=WBStrain00031400

Source Database: WormBase (WB)
Affected Genes: WBGene00000195(arr-1)
Genomic Alteration: WBGene00000195(arr-1)
Availability: available
Source References: PMID:37310929
Synonyms: arr-1(ok401) X.
Alternate IDs: WB-STRAIN:RB660, CGC_RB660
Notes: F53H8.2. Homozygous. Outer Left Sequence: agttttatgccgctctcgaa. Outer Right Sequence: tcaattcgttccccactctc. Inner Left Sequence: caacttttccgccacataca. Inner Right Sequence: atggcggaagtttaccctct. Inner primer WT PCR product: 2402.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00031400 Copy   


  • RRID:WB-STRAIN:WBStrain00031374

http://www.wormbase.org/db/get?name=WBStrain00031374

Source Database: WormBase (WB)
Affected Genes: WBGene00001510(fzr-1)
Genomic Alteration: WBGene00001510(fzr-1)
Availability: available
Source References: EMPTY
Synonyms: fzr-1(ok380) II.
Alternate IDs: WB-STRAIN:RB622, CGC_RB622
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK1307.6. Superficially wild type."

Proper citation: RRID:WB-STRAIN:WBStrain00031374 Copy   


  • RRID:WB-STRAIN:WBStrain00031372

http://www.wormbase.org/db/get?name=WBStrain00031372

Source Database: WormBase (WB)
Affected Genes: WBGene00006461(tag-96)
Genomic Alteration: WBGene00006461(tag-96)
Availability: available
Source References: EMPTY
Synonyms: tag-96(ok336) IV.
Alternate IDs: WB-STRAIN:RB608, CGC_RB608
Notes: M01D7.4. Superficially wild type.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00031372 Copy   


  • RRID:WB-STRAIN:WBStrain00031371

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00031371

Source Database: WormBase (WB)
Affected Genes: WBGene00003750(nlp-12)
Genomic Alteration: WBGene00003750(nlp-12)
Availability: available
Source References: PMID:33524034
Synonyms: nlp-12(ok335) I.
Alternate IDs: WB-STRAIN:RB607, CGC_RB607
Notes: M01D7.5. Superficially wild type.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060969 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00031371 Copy   


  • RRID:WB-STRAIN:WBStrain00031378

http://www.wormbase.org/db/get?name=WBStrain00031378

Source Database: WormBase (WB)
Affected Genes: WBGene00005643(srp-2)
Genomic Alteration: WBGene00005643(srp-2)
Availability: available
Source References: EMPTY
Synonyms: srp-2(ok350) V.
Alternate IDs: WB-STRAIN:RB631, CGC_RB631
Notes: C05E4.1. Homozygous. Outer Left Sequence: CTTACTGCCGCAAATCTTCGCGA . Outer Right Sequence: GTTGCGTAGAACTTTCGAGCCTA. Inner Left Sequence: CACTTTATGACGGCACAAAAAAG. Inner Right Sequence: GTGTTATTCTAATTGTCTCGGAAC. Inner primer WT PCR product: 2719.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00031378 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Kravitz Dataset1 Resources

    Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within Kravitz that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X