Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00057291
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37473700
Synonyms: smg-1(cc546);unc-64(e246);dvIs27[myo-3p::1-42::let-851 3'UTR +rol-6(su1006)]; Ex[rgef-1p::pbs-5 + myo-2p::GFP+ unc-119(+)]
Notes: Strain designation NCA not approved by genenames|"Supplementary_genotype smg-1(cc546);unc-64(e246);dvIs27[myo-3p::1-42::let-851 3'UTR +rol-6(su1006)]; Ex[rgef-1p::pbs-5 + myo-2p::GFP+ unc-119(+)]"
Proper citation: RRID:WB-STRAIN:WBStrain00057291 Copy
http://www.wormbase.org/db/get?name=WBStrain00057292
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37722038
Synonyms: [Pdyf-7::mCherry::PH_unc-54_3UTR + unc-119(+)](ltSi1033) II; unc-119(ed3) III
Notes: Supplementary_genotype [Pdyf-7::mCherry::PH_unc-54_3UTR + unc-119(+)](ltSi1033) II; unc-119(ed3) III(10) OD3152
Proper citation: RRID:WB-STRAIN:WBStrain00057292 Copy
http://www.wormbase.org/db/get?name=WBStrain00057290
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37473700
Synonyms: unc-64(e246); dvls100[unc-54p::A1-42::unc-54 3'-UTR +mtl-2p::GFP]; Ex[myo-2p::GFP +unc-119(+)]
Notes: Strain designation NCA not approved by genenames|"Supplementary_genotype unc-64(e246); dvls100[unc-54p::A1-42::unc-54 3'-UTR +mtl-2p::GFP]; Ex[myo-2p::GFP +unc-119(+)]"
Proper citation: RRID:WB-STRAIN:WBStrain00057290 Copy
http://www.wormbase.org/db/get?name=WBStrain00057314
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37722055
Synonyms: glp-1(e2141)III; sid-1(pk3321) V; uIs69 [pCFJ90 (myo-2p::mCherry) + unc-119p::sid-1]; rmIs132 [unc-54p::Q35::YFP]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00057314 Copy
http://www.wormbase.org/db/get?name=WBStrain00057315
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37722055
Synonyms: glp-1(e2141)III; sid-1(pk3321) V; uIs69 [pCFJ90 (myo-2p::mCherry) + unc-119p::sid-1]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00057315 Copy
http://www.wormbase.org/db/get?name=WBStrain00057277
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37473700
Synonyms: xzIs2[unc-54p::UIM2::ZsProSensor-1]; Ex[rgef-1p::pbs-5 + myo-2p::GFP +unc-119(+)]
Notes: Strain designation NCA not approved by genenames|"Supplementary_genotype xzIs2[unc-54p::UIM2::ZsProSensor-1]; Ex[rgef-1p::pbs-5 + myo-2p::GFP +unc-119(+)]"
Proper citation: RRID:WB-STRAIN:WBStrain00057277 Copy
http://www.wormbase.org/db/get?name=WBStrain00057310
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37670562
Synonyms: lin-41(tn1487ts[D1125N])I; cfp-1(syb3876[cfp-1::mCherry::myc])IV
Notes: Supplementary_genotype lin-41(tn1487ts[D1125N])I; cfp-1(syb3876[cfp-1::mCherry::myc])IV
Proper citation: RRID:WB-STRAIN:WBStrain00057310 Copy
http://www.wormbase.org/db/get?name=WBStrain00057278
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37473700
Synonyms: xzIs2[unc-54p::UIM2::ZsProSensor-1];Ex[let-858p::pbs-5 +myo-2p::GFP +unc-119(+)]
Notes: Strain designation NCA not approved by genenames|"Supplementary_genotype xzIs2[unc-54p::UIM2::ZsProSensor-1];Ex[let-858p::pbs-5 +myo-2p::GFP +unc-119(+)]"
Proper citation: RRID:WB-STRAIN:WBStrain00057278 Copy
http://www.wormbase.org/db/get?name=WBStrain00057311
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37670562
Synonyms: syb1s5469[(Pmex-5::gfp::H2B::PEST::cfp-1 3UTR) II];unc-119(ed3) III
Notes: Supplementary_genotype syb1s5469[(Pmex-5::gfp::H2B::PEST::cfp-1 3'UTR) II];unc-119(ed3) III
Proper citation: RRID:WB-STRAIN:WBStrain00057311 Copy
http://www.wormbase.org/db/get?name=WBStrain00057275
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37473700
Synonyms: xzIs2[unc-54p::UIM2::ZsProSensor-1];Ex[myo-2p::GFP + unc-119(+)]
Notes: Strain designation NCA not approved by genenames|"Supplementary_genotype xzIs2[unc-54p::UIM2::ZsProSensor-1];Ex[myo-2p::GFP + unc-119(+)]"
Proper citation: RRID:WB-STRAIN:WBStrain00057275 Copy
http://www.wormbase.org/db/get?name=WBStrain00057276
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37473700
Synonyms: xzIs2[unc-54p::UIM2::ZsProSensor-1]; Ex[myo-3p::pbs-5 +myo-2p::GFP +unc-119(+)]
Notes: Strain designation NCA not approved by genenames|"Supplementary_genotype xzIs2[unc-54p::UIM2::ZsProSensor-1]; Ex[myo-3p::pbs-5 +myo-2p::GFP +unc-119(+)]"
Proper citation: RRID:WB-STRAIN:WBStrain00057276 Copy
http://www.wormbase.org/db/get?name=WBStrain00057318
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37722055
Synonyms: glp-1(e2141)III; rde-1(ne219) V; kzIs20 [hlh-1p::rde-1 + sur-5p::NLS::GFP]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00057318 Copy
http://www.wormbase.org/db/get?name=WBStrain00057319
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37722055
Synonyms: daf-2(e1370) III; sid-1(pk3321) V; uIs69 [pCFJ90 (myo-2p::mCherry) + unc-119p::sid-1]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00057319 Copy
http://www.wormbase.org/db/get?name=WBStrain00057317
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37722055
Synonyms: glp-1(e2141)III; rde-1(ne219) V; kzIs9[(pKK1260) lin-26p::NLS::GFP + (pKK1253) lin-26p::rde-1 + rol-6(su1006)]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00057317 Copy
http://www.wormbase.org/db/get?name=WBStrain00057284
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37473700
Synonyms: unc-64(e246); xzIs2[unc-54p::UIM2::ZsProSensor-1];Ex[rgef-1p::pbs-5 + myo-2p::GFP+unc-119(+)]
Notes: Strain designation NCA not approved by genenames|"Supplementary_genotype unc-64(e246); xzIs2[unc-54p::UIM2::ZsProSensor-1];Ex[rgef-1p::pbs-5 + myo-2p::GFP+unc-119(+)]"
Proper citation: RRID:WB-STRAIN:WBStrain00057284 Copy
http://www.wormbase.org/db/get?name=WBStrain00057285
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37473700
Synonyms: unc-64(e246); xzIs2[unc-54p::UIM2::ZsProSensor-1]; Ex[myo-2p::GFP +unc-119(+)]
Notes: Strain designation NCA not approved by genenames|"Supplementary_genotype unc-64(e246); xzIs2[unc-54p::UIM2::ZsProSensor-1]; Ex[myo-2p::GFP +unc-119(+)]"
Proper citation: RRID:WB-STRAIN:WBStrain00057285 Copy
http://www.wormbase.org/db/get?name=WBStrain00057283
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37473700
Synonyms: unc-31(e928); xzIs2[unc-54p::UIM2::ZsProSensor-1];Ex[rgef-1p::pbs-5 + myo-2p::GFP+unc-119(+)]
Notes: Strain designation NCA not approved by genenames|"Supplementary_genotype unc-31(e928); xzIs2[unc-54p::UIM2::ZsProSensor-1];Ex[rgef-1p::pbs-5 + myo-2p::GFP+unc-119(+)]"
Proper citation: RRID:WB-STRAIN:WBStrain00057283 Copy
http://www.wormbase.org/db/get?name=WBStrain00057280
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37473700
Synonyms: unc-13(e51); xzIs2[unc-54p::UIM2::ZsProSensor-1]; Ex[myo-2p::GFP + unc-119(+)]
Notes: Strain designation NCA not approved by genenames|"Supplementary_genotype unc-13(e51); xzIs2[unc-54p::UIM2::ZsProSensor-1]; Ex[myo-2p::GFP + unc-119(+)]"
Proper citation: RRID:WB-STRAIN:WBStrain00057280 Copy
http://www.wormbase.org/db/get?name=WBStrain00057302
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37721936
Synonyms: dpy-17(syb7589 syb3685 [DPY-17(R61A R63A R64A)::mNeonGreen]) III
Notes: DPY-17(R61A R63A R64A)::mNG endogeous fusion
Proper citation: RRID:WB-STRAIN:WBStrain00057302 Copy
http://www.wormbase.org/db/get?name=WBStrain00057300
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)
Genomic Alteration: WBGene00000254(bli-4)
Availability: unknown
Source References: PMID:37721936
Synonyms: bli-4(syb5321[bli-4::SfGFP(int)]) I.
Notes: bli-4 translational reporter, endogenous fusion|"bli-4 translational reporter. SfGFP inserted in endogenous locus in 3rd exon of BLI-4 between Pro and peptidase domains. CAGCAGCCACAGTCTCCACGAGAA -> CAGCAGCCACAG^TCTCCACGAGAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936."|"Made_by: SUNY Biotech"
Proper citation: RRID:WB-STRAIN:WBStrain00057300 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within Kravitz that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
