Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
RG3028
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033355 Caenorhabditis elegans C40H5.7(ve528[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTGTGAGCGAATTGTTAAATGGAGTGGCTT ; Right flanking sequence: atcacatgtcatatacagtattccattaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CTGTGAGCGAATTGTTAAATGGAGTGGCTT ; Right flanking sequence: atcacatgtcatatacagtattccattaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C40H5.7. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: CTGTGAGCGAATTGTTAAATGGAGTGGCTT Right flanking sequence: atcacatgtcatatacagtattccattaaa" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00033355 WormBase (WB) WB available WB-STRAIN:RG3028, CGC_RG3028 2026-09-05 04:52:59 0
RG3030
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033357 Caenorhabditis elegans C46F4.3(ve530[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 794 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCTTACTTTCCGTTTCTGCAAAACAAGTG ; Right flanking sequence: GGAGGAGTCTGCAGACCGTCGACAAAGTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 794 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATCTTACTTTCCGTTTCTGCAAAACAAGTG ; Right flanking sequence: GGAGGAGTCTGCAGACCGTCGACAAAGTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C46F4.3. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ATCTTACTTTCCGTTTCTGCAAAACAAGTG Right flanking sequence: GGAGGAGTCTGCAGACCGTCGACAAAGTGC" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00033357 WormBase (WB) WB available WB-STRAIN:RG3030, CGC_RG3030 2026-09-05 04:53:00 0
RG3033
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033360 Caenorhabditis elegans igeg-2(ve533[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 1425 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTTAATAGTTGTCGTCGAGTACTTGGAGT ; Right flanking sequence: TGTGGTTCCCGTGTGTGTTCCTTcttaaat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1425 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TGTTAATAGTTGTCGTCGAGTACTTGGAGT ; Right flanking sequence: TGTGGTTCCCGTGTGTGTTCCTTcttaaat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of igeg-2. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: TGTTAATAGTTGTCGTCGAGTACTTGGAGT Right flanking sequence: TGTGGTTCCCGTGTGTGTTCCTTcttaaat" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00009842(igeg-2) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00009842(igeg-2) WB-STRAIN:WBStrain00033360 WormBase (WB) WB available WB-STRAIN:RG3033, CGC_RG3033 2026-09-05 04:53:00 0
RG733
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00033326 Caenorhabditis elegans wIs78 IV. wIs78 [SCMp::GFP + ajm-1p::GFP + F58E10 (cosmid) + unc-119(+)] IV. GFP expression in seam cells and adherens junctions. Check periodically for GFP in seam cells to retain robust expression. ajm-1 previously called jam-1. Derived by outcrossing JR1000. It is not know whether the ced-1(e1735) or unc-119(ed4) mutations are still present, as the array rescues both phenotypes. wIs78 males do not mate very well; heterozygotes mate fine.|"wIs78 [SCMp::GFP + ajm-1p::GFP + F58E10 (cosmid) + unc-119(+)]. GFP expression in seam cells and adherens junctions. ajm-1 previously called jam-1. Derived by outcrossing JR1000. It is not know whether the ced-1(e1735) or unc-119(ed4) mutations are still present, as the array rescues both phenotypes. wIs78 males do not mate very well; heterozygotes mate fine."|"wIs78 [SCMp::GFP + ajm-1p::GFP + F58E10 (cosmid) + unc-119(+)]. GFP expression in seam cells and adherens junctions. Check periodically for GFP in seam cells to retain robust expression. ajm-1 previously called jam-1. Derived by outcrossing JR1000. It is not know whether the ced-1(e1735) or unc-119(ed4) mutations are still present, as the array rescues both phenotypes. wIs78 males do not mate very well; heterozygotes mate fine." WBGene00000100(ajm-1) WBGene00000100(ajm-1) WB-STRAIN:WBStrain00033326 WormBase (WB) WB available PMID:31307392 WB-STRAIN:RG733, CGC_RG733 2026-09-05 04:52:59 1
RG1590
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033329 Caenorhabditis elegans EMPTY EMPTY WB-STRAIN:WBStrain00033329 WormBase (WB) WB unknown PMID:38839826 WB-STRAIN:RG1590 2026-09-05 04:52:59 0
RG93
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033321 Caenorhabditis elegans lin-29(ve5) rol-1(e91)/mnC1 [dpy-10(e128) unc-52(e444)] II. Heterozygotes are WT and segregate WT, Egls which have a protruding vulva, and DpyUncs. Maintain by picking WT. lin-29 suppresses rol-1 phenotype (rol-1 is an adult specific Roller and lin-29 animals never molt to adult cuticle). WBGene00001072(dpy-10)|WBGene00003015(lin-29)|WBGene00004394(rol-1)|WBGene00006787(unc-52) WBGene00001072(dpy-10), WBGene00003015(lin-29), WBGene00004394(rol-1), WBGene00006787(unc-52) WB-STRAIN:WBStrain00033321 WormBase (WB) WB available PMID:7671813 WB-STRAIN:RG93, CGC_RG93 2026-09-05 04:52:59 0
RG174
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033322 Caenorhabditis elegans EMPTY EMPTY WBGene00001953(hlh-8) WBGene00001953(hlh-8) WB-STRAIN:WBStrain00033322 WormBase (WB) WB unknown WB-STRAIN:RG174 2026-09-05 04:52:59 0
RG365
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033323 Caenorhabditis elegans EMPTY EMPTY WBGene00000608(col-19) WBGene00000608(col-19) WB-STRAIN:WBStrain00033323 WormBase (WB) WB unknown WB-STRAIN:RG365 2026-09-05 04:52:59 0
RG3007
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033336 Caenorhabditis elegans sra-28(ve507[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 3237 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aggaaaattaaatttcaattttcttgttcc ; Right flanking sequence: ggaggtgttagcttttaaaatatgactggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 3237 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aggaaaattaaatttcaattttcttgttcc ; Right flanking sequence: ggaggtgttagcttttaaaatatgactggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-28. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites." WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005054(sra-28)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005054(sra-28), WBGene00006789(unc-54) WB-STRAIN:WBStrain00033336 WormBase (WB) WB available WB-STRAIN:RG3007, CGC_RG3007 2026-09-05 04:52:59 0
RG3011
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033338 Caenorhabditis elegans sra-17(ve511[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1733 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC ; Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1733 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC ; Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Emily Lorenz-Mueller"|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-17. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT"|"WBStrain provided so WBPaper00061836 paper added based on AFP_Strain data." WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005043(sra-17)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005043(sra-17), WBGene00006789(unc-54) WB-STRAIN:WBStrain00033338 WormBase (WB) WB available PMID:34429473 WB-STRAIN:RG3011, CGC_RG3011 2026-09-05 04:52:59 0
RG3012
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033339 Caenorhabditis elegans sra-27(ve512[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctcttagtattattattatttgttccccct ; Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ctcttagtattattattatttgttccccct ; Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Emily Lorenz-Mueller"|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-27. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ctcttagtattattattatttgttccccct Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005053(sra-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005053(sra-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00033339 WormBase (WB) WB available WB-STRAIN:RG3012, CGC_RG3012 2026-09-05 04:52:59 0
RG3000
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033330 Caenorhabditis elegans sra-34(ve500[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-34. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: GAATTAATACAAACAACAGGAGCTGGAACA Right flanking sequence: gaaggtattgaataaaacgcggaagttcta" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005060(sra-34)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005060(sra-34), WBGene00006789(unc-54) WB-STRAIN:WBStrain00033330 WormBase (WB) WB available WB-STRAIN:RG3000, CGC_RG3000 2026-09-05 04:52:59 0
RG3004
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033334 Caenorhabditis elegans sra-4(ve504[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Emily Lorenz-Mueller"|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-4. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ggtgtgaaagattttaaataaacaccctcg Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005030(sra-4)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005030(sra-4), WBGene00006789(unc-54) WB-STRAIN:WBStrain00033334 WormBase (WB) WB available WB-STRAIN:RG3004, CGC_RG3004 2026-09-05 04:52:59 0
RG3006
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033335 Caenorhabditis elegans sra-31(ve506[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-31. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites." WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005057(sra-31)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005057(sra-31), WBGene00006789(unc-54) WB-STRAIN:WBStrain00033335 WormBase (WB) WB available WB-STRAIN:RG3006, CGC_RG3006 2026-09-05 04:52:59 0
RP828
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033425 Caenorhabditis elegans madd-2(tr103) V. Midline-oriented migration defects including muscle arm extension and HSN, AVM, and PVM axon guidance defects. Reference: Alexander M, et al. Dev Cell. 2010 Jun 15;18(6):961-72. WBGene00016539(madd-2) WBGene00016539(madd-2) WB-STRAIN:WBStrain00033425 WormBase (WB) WB available WB-STRAIN:RP828, CGC_RP828 2026-09-05 04:53:00 0
RP1416
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033426 Caenorhabditis elegans madd-2(tr129) V. Midline-oriented migration defects including muscle arm extension and HSN, AVM, and PVM axon guidance defects. Reference: Alexander M, et al. Dev Cell. 2010 Jun 15;18(6):961-72. WBGene00016539(madd-2) WBGene00016539(madd-2) WB-STRAIN:WBStrain00033426 WormBase (WB) WB available WB-STRAIN:RP1416, CGC_RP1416 2026-09-05 04:53:00 0
RP2635
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033427 Caenorhabditis elegans mev-1(tr355) III. EMPTY WBGene00003225(mev-1) WBGene00003225(mev-1) WB-STRAIN:WBStrain00033427 WormBase (WB) WB unknown PMID:26108372
PMID:38719808
WB-STRAIN:RP2635 2026-09-05 04:53:00 0
RP2636
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033428 Caenorhabditis elegans sdhb-1(tr356) II. EMPTY WBGene00006433(sdhb-1) WBGene00006433(sdhb-1) WB-STRAIN:WBStrain00033428 WormBase (WB) WB unknown PMID:26108372 WB-STRAIN:RP2636 2026-09-05 04:53:00 0
RP2637
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033429 Caenorhabditis elegans mev-1(tr357) III. EMPTY WBGene00003225(mev-1) WBGene00003225(mev-1) WB-STRAIN:WBStrain00033429 WormBase (WB) WB available PMID:26108372 WB-STRAIN:RP2637, CGC_RP2637 2026-09-05 04:53:00 0
RP582
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033420 Caenorhabditis elegans egl-19(tr69) IV. Made_by: T Kwok/P Roy|"Nemadipine-A resistant." WBGene00001187(egl-19) WBGene00001187(egl-19) WB-STRAIN:WBStrain00033420 WormBase (WB) WB available WB-STRAIN:RP582, CGC_RP582 2026-09-05 04:53:00 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Kravitz Dataset1 Resources

    Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.