Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
RB2537
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033212 Caenorhabditis elegans T02C12.4(ok3518) III. Made_by: OMRF Knockout Group|"T02C12.4 Homozygous. Outer Left Sequence: gcgaaaggagcattcttcag. Outer Right Sequence: gaggaggaaaacgtggtgaa. Inner Left Sequence: aatttcttgatttcagccagc. Inner Right Sequence: caatggatcgaatggaacaa. Inner Primer PCR Length: 1189. Estimated Deletion Size: about 600 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00011369(T02C12.4) WBGene00011369(T02C12.4) WB-STRAIN:WBStrain00033212 WormBase (WB) WB available WB-STRAIN:RB2537, CGC_RB2537 2026-09-05 04:52:58 0
RB2538
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033213 Caenorhabditis elegans Y44E3A.3(ok3519) I. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y44E3A.3 Homozygous. Outer Left Sequence: tatcgctgccacaattcaaa. Outer Right Sequence: acgcgaacgctaaaattctg. Inner Left Sequence: ccgtaaatcgacacaagtgc. Inner Right Sequence: gcgtattgagcaaaagacgaa. Inner Primer PCR Length: 1206. Estimated Deletion Size: about 300 bp." WBGene00021548(trx-4) WBGene00021548(trx-4) WB-STRAIN:WBStrain00033213 WormBase (WB) WB available WB-STRAIN:RB2538, CGC_RB2538 2026-09-05 04:52:58 0
RB5000
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033304 Caenorhabditis elegans dpy-1(ok5083) III. Made_by: OMRF KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Whole-genome sequenced strain. Dpy. It has not been confirmed that this phenotype is the result of ok5083. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to ok5083, it is homozygous for 196 other mutations determined from sequence data. All mutations are annotated in WormBase." WBGene00001063(dpy-1) WBGene00001063(dpy-1) WB-STRAIN:WBStrain00033304 WormBase (WB) WB available WB-STRAIN:RB5000, CGC_RB5000 2026-09-05 04:52:59 0
RB5001
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033305 Caenorhabditis elegans Whole-genome sequenced strain. Made_by: OMRF KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Whole-genome sequenced strain. Dpy. The mutation responsible for this phenotype has not been identified. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). It is homozygous for 289 mutations determined from sequence data, all of which are annotated in WormBase." WB-STRAIN:WBStrain00033305 WormBase (WB) WB available WB-STRAIN:RB5001, CGC_RB5001 2026-09-05 04:52:59 0
RBW2642
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033307 Caenorhabditis elegans hutSi2642 II; unc-119(ed3) III. hutSi2642 [hsp-90p::mCherry::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mCherry from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110. WBGene00006843(unc-119) WBGene00006843(unc-119) WB-STRAIN:WBStrain00033307 WormBase (WB) WB available WB-STRAIN:RBW2642, CGC_RBW2642 2026-09-05 04:52:59 0
RBW2661
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033308 Caenorhabditis elegans hutSi2661 II; unc-119(ed3) III hutSi2661 [hsp-90p::eGFPT::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mEGFP from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110. WBGene00006843(unc-119) WBGene00006843(unc-119) WB-STRAIN:WBStrain00033308 WormBase (WB) WB available WB-STRAIN:RBW2661, CGC_RBW2661 2026-09-05 04:52:59 0
RC301
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00033309 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Reference WBG 9(3) 29 and 10(2) 140-141. npr-1 pka bor-1. Caenorhabditis elegans wild isolate (Tc1 pattern HCF).|"Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search." WB-STRAIN:WBStrain00033309 WormBase (WB) WB available PMID:9136008
PMID:9741632
PMID:18801967
PMID:18993077
PMID:31704915
PMID:33820969
PMID:38564369
WB-STRAIN:RC301, CGC_RC301 2026-09-05 04:52:59 1
RM1677
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033384 Caenorhabditis elegans unc-41(md152) V. unc-41(md152) is a 1 bp deletion after amino acid 872 in exon 8 producing GLHKS*. wt sequence: GCTAACTCTTGTGCAGCCCG. md152 sequence: GCTAACTCTTGTGCAGCCCA. WBGene00006777(unc-41) WBGene00006777(unc-41) WB-STRAIN:WBStrain00033384 WormBase (WB) WB unknown WB-STRAIN:RM1677 2026-09-05 04:53:00 0
RM1702
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033385 Caenorhabditis elegans ric-8(md303) IV. Made_by: J. Rand/K. Miller|"Ric, Egl, severely locomotion defective, reduced body flexion/straight posture, pharyngeal pumping and growth rate slightly lower than WT. Does not reproduce at 25C. Brood size about 1/10 of WT at 20C, and about 1/3 of WT at 14C. 29% of eggs do not hatch. Early embryogenesis defects include misalignment of mitotic spindles and delayed migration of nuclei. Grows best at 14C but you can still work with it and do crosses at 20C." WBGene00004367(ric-8) WBGene00004367(ric-8) WB-STRAIN:WBStrain00033385 WormBase (WB) WB available PMID:8901627 WB-STRAIN:RM1702, CGC_RM1702 2026-09-05 04:53:00 0
RM1845
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033387 Caenorhabditis elegans cat-1(e1111) X. Catecholamine abnormal. See Duerr JS, et al. J Neurosci. 1999 Jan 1;19(1):72-84. for description of phenotypes. WBGene00000295(cat-1) WBGene00000295(cat-1) WB-STRAIN:WBStrain00033387 WormBase (WB) WB available WB-STRAIN:RM1845, CGC_RM1845 2026-09-05 04:53:00 0
RM2037
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033389 Caenorhabditis elegans unc-17(e245) cho-1(tm373) IV. Loosely-linked (~12 cM apart) cholinergic mutants. Aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. cho-1(tm373) is a null deletion allele of the gene encoding the plasma membrane choline transporter, and unc-17(e245) is a strong missense allele of the synaptic vesicle acetylcholine transporter. References: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.|"Made_by: Mai Vu" WBGene00000501(cho-1)|WBGene00006756(unc-17) WBGene00000501(cho-1), WBGene00006756(unc-17) WB-STRAIN:WBStrain00033389 WormBase (WB) WB available WB-STRAIN:RM2037, CGC_RM2037 2026-09-05 04:53:00 0
RM2431
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033392 Caenorhabditis elegans unc-13(md2415)/hT1 I; +/hT1 V. Heterozygotes are WT and segregate WT, hT1 homozygotes (mid-larval lethals), md2415 homozygotes (generally L1 lethals which are almost completely paralyzed and have a coily posture with some head movement), and dead eggs. md2415 has a 2.7 kb deletion in the unc-13R region.|"Made_by: Moulder/Eustance-Koh"|"Mutagen: Psoralen"|"Supplementary_genotype unc-13(md2415)/hT1 I; +/hT1 V." WBGene00006752(unc-13) WBGene00006752(unc-13) WB-STRAIN:WBStrain00033392 WormBase (WB) WB available PMID:36617680 WB-STRAIN:RM2431, CGC_RM2431 2026-09-05 04:53:00 0
RE666
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00033316 Caenorhabditis elegans ire-1(v33) II. Made_by: X. Shen|"Slow growth. Abnormal tail."|"Supplementary_genotype ire-1(v33) II" WBGene00002147(ire-1) WBGene00002147(ire-1) WB-STRAIN:WBStrain00033316 WormBase (WB) WB available PMID:33542359
PMID:36924492
PMID:39436952
WB-STRAIN:RE666, CGC_RE666 2026-09-05 04:52:59 2
RFK607
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033318 Caenorhabditis elegans gtsf-1(xf43) IV. Eri, reduced brood size at 20C and sterility at 25C. Slightly Him. Reference: Almeida et al, 2018. The EMBO Journal, e99325. WBGene00020286(gtsf-1) WBGene00020286(gtsf-1) WB-STRAIN:WBStrain00033318 WormBase (WB) WB available WB-STRAIN:RFK607, CGC_RFK607 2026-09-05 04:52:59 0
RFK608
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033319 Caenorhabditis elegans gtsf-1(xf44) IV. Eri, reduced brood size at 20C and sterility at 25C. Slightly Him. Reference: Almeida et al, 2018. The EMBO Journal, e99325. WBGene00020286(gtsf-1) WBGene00020286(gtsf-1) WB-STRAIN:WBStrain00033319 WormBase (WB) WB available WB-STRAIN:RFK608, CGC_RFK608 2026-09-05 04:52:59 0
RM2710
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00033395 Caenorhabditis elegans snf-11(ok156) V. Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"No obvious phenotype."|"Superficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30." WBGene00004910(snf-11) WBGene00004910(snf-11) WB-STRAIN:WBStrain00033395 WormBase (WB) WB available PMID:31415799 WB-STRAIN:RM2710, CGC_RM2710 2026-09-05 04:53:00 1
RM2711
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033396 Caenorhabditis elegans unc-25(e156) III; snf-11(ok156) V. Superficially similar to unc-25 mutants (Shrinker, Exp, etc.), except that unc-25-dependent behaviors are not rescued by exogenous GABA. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30. WBGene00004910(snf-11)|WBGene00006762(unc-25) WBGene00004910(snf-11), WBGene00006762(unc-25) WB-STRAIN:WBStrain00033396 WormBase (WB) WB available WB-STRAIN:RM2711, CGC_RM2711 2026-09-05 04:53:00 0
RC399
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033310 Caenorhabditis elegans mett-10(g38) dpy-18(e364) III. Dpy. Maternal effect temperature sensitive embryonic lethal - leaky. Maintain at 15C. mett-10 was formerly known as let-42. WBGene00001077(dpy-18)|WBGene00014228(mett-10) WBGene00001077(dpy-18), WBGene00014228(mett-10) WB-STRAIN:WBStrain00033310 WormBase (WB) WB available PMID:7250492 WB-STRAIN:RC399, CGC_RC399 2026-09-05 04:52:59 0
RDV55
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033312 Caenorhabditis elegans rdvIs1 III. rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.|"Supplementary_genotype rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III" WB-STRAIN:WBStrain00033312 WormBase (WB) WB available PMID:37651423
PMID:39525282
WB-STRAIN:RDV55, CGC_RDV55 2026-09-05 04:52:59 0
RL67
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033369 Caenorhabditis elegans lon-1(e185) let-711(it150) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III. Heterozygotes are WT and segregate WT, Dpy Steriles, and Lon Uncs which are temperature sensitive maternal effect lethals. Embryos from homozygyous it150 hermaphrodites have spindle orientation defects at second and third cleave at 25C.|"Made_by: L. DeBella/L. Rose" WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00002845(let-711)|WBGene00003055(lon-1)|WBGene00006768(unc-32) WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00002845(let-711), WBGene00003055(lon-1), WBGene00006768(unc-32) WB-STRAIN:WBStrain00033369 WormBase (WB) WB available WB-STRAIN:RL67, CGC_RL67 2026-09-05 04:53:00 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Kravitz Dataset1 Resources

    Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.