Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00030671
Source Database: WormBase (WB)
Affected Genes: WBGene00001995(hpl-1)
Genomic Alteration: WBGene00001995(hpl-1)
Availability: available
Source References: EMPTY
Synonyms: hpl-1(tm1624) X.
Alternate IDs: WB-STRAIN:PFR60, CGC_PFR60
Notes: Wild type phenotype.
Proper citation: RRID:WB-STRAIN:WBStrain00030671 Copy
http://www.wormbase.org/db/get?name=WBStrain00030678
Source Database: WormBase (WB)
Affected Genes: WBGene00000278(cad-1)
Genomic Alteration: WBGene00000278(cad-1)
Availability: available
Source References: PMID:3396869
Synonyms: cad-1(j1) II.
Alternate IDs: WB-STRAIN:PJ1, CGC_PJ1
Notes: Small. Egg retainer. Little or no reproduction at 25C. Gut transparent. 90% reduced cathepsin.
Proper citation: RRID:WB-STRAIN:WBStrain00030678 Copy
http://www.wormbase.org/db/get?name=WBStrain00030674
Source Database: WormBase (WB)
Affected Genes: WBGene00000485(che-3)
Genomic Alteration: WBGene00000485(che-3)
Availability: available
Source References: PMID:3596232
Synonyms: che-3(hf5) I.
Alternate IDs: WB-STRAIN:PH31, CGC_PH31
Notes: Resistant to caffeine. Previously called caf-2(hf5).
Proper citation: RRID:WB-STRAIN:WBStrain00030674 Copy
http://www.wormbase.org/db/get?name=WBStrain00030683
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00006787(unc-52)
Availability: available
Source References: PMID:3396869
Synonyms: jDf2/mnC1 [dpy-10(e128) unc-52(e444)] II.
Alternate IDs: WB-STRAIN:PJ803, CGC_PJ803
Notes: Heterozygotes are Unc (Paralyzed adult) and segregate more Unc, DpyUnc and dead eggs. Pick Unc to maintain. Balanced well.|"Made_by: Pollock R"|"Mutagen:Gamma ray"
Proper citation: RRID:WB-STRAIN:WBStrain00030683 Copy
http://www.wormbase.org/db/get?name=WBStrain00030684
Source Database: WormBase (WB)
Affected Genes: WBGene00002486(let-257)|WBGene00006744(unc-4)
Genomic Alteration: WBGene00002486(let-257), WBGene00006744(unc-4)
Availability: available
Source References: PMID:3396869
Synonyms: unc-4(e120) jDf4/unc-4(e120) let-257(mn235) II.
Alternate IDs: WB-STRAIN:PJ821, CGC_PJ821
Notes: Heterozygotes are Unc and segregate Unc, dead eggs and UncLets. Lethal in larval development. Also reference 710.
Proper citation: RRID:WB-STRAIN:WBStrain00030684 Copy
http://www.wormbase.org/db/get?name=WBStrain00030681
Source Database: WormBase (WB)
Affected Genes: WBGene00000278(cad-1)|WBGene00000900(daf-4)
Genomic Alteration: WBGene00000278(cad-1), WBGene00000900(daf-4)
Availability: available
Source References: PMID:3396869
Synonyms: cad-1(j1) II; daf-4(e1364) III.
Alternate IDs: WB-STRAIN:PJ105, CGC_PJ105
Notes: Very small, almost Dpy. Temperature sensitive dauer constitutive. Many dauers at 16C. Reduced cathepsin.
Proper citation: RRID:WB-STRAIN:WBStrain00030681 Copy
http://www.wormbase.org/db/get?name=WBStrain00030682
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00006787(unc-52)
Availability: available
Source References: PMID:3396869
Synonyms: jDf1/mnC1 [dpy-10(e128) unc-52(e444)] II.
Alternate IDs: WB-STRAIN:PJ801, CGC_PJ801
Notes: Heterozygotes are Unc (Paralyzed adult) and segregate more Uncs, DpyUncs and dead eggs. Growth slow. Pick Unc to maintain. Crossover suppressed.|"Mutagen:Gamma Rays"
Proper citation: RRID:WB-STRAIN:WBStrain00030682 Copy
http://www.wormbase.org/db/get?name=WBStrain00030680
Source Database: WormBase (WB)
Affected Genes: WBGene00000278(cad-1)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00000278(cad-1), WBGene00006787(unc-52)
Availability: available
Source References: PMID:3396869
Synonyms: cad-1(j1) unc-52(e669) II.
Alternate IDs: WB-STRAIN:PJ104, CGC_PJ104
Notes: Unc-progressive paralysis. Reduced cathepsin.
Proper citation: RRID:WB-STRAIN:WBStrain00030680 Copy
http://www.wormbase.org/db/get?name=WBStrain00030603
Source Database: WormBase (WB)
Affected Genes: WBGene00004010(pha-1)
Genomic Alteration: WBGene00004010(pha-1)
Availability: available
Source References: EMPTY
Synonyms: pha-1(e2123) III; ccEx7271.
Alternate IDs: WB-STRAIN:PD7271, CGC_PD7271
Notes: ccEx7271 [let-858::GFP + pha-1(+)]. This strain expresses nuclear-localized GFP in all somatic nuclei, but reduced or no GFP in germ cells. If maintained at 20C, pha-1(ts) genotype will select for transgenic animals. Sporadic germ cell expression can be observed when maintained at 25C.
Proper citation: RRID:WB-STRAIN:WBStrain00030603 Copy
http://www.wormbase.org/db/get?name=WBStrain00030604
Source Database: WormBase (WB)
Affected Genes: WBGene00001948(hlh-1)
Genomic Alteration: WBGene00001948(hlh-1)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:PD7963
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00030604 Copy
http://www.wormbase.org/db/get?name=WBStrain00030602
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00002955(let-856)|WBGene00006744(unc-4)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00002955(let-856), WBGene00006744(unc-4), WBGene00006787(unc-52)
Availability: available
Source References: PMID:9136012
Synonyms: let-856(cc529) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II.
Alternate IDs: WB-STRAIN:PD7244, CGC_PD7244
Notes: Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals.
Proper citation: RRID:WB-STRAIN:WBStrain00030602 Copy
http://www.wormbase.org/db/get?name=WBStrain00030687
Source Database: WormBase (WB)
Affected Genes: WBGene00006765(unc-29)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00006765(unc-29), WBGene00006789(unc-54)
Availability: available
Source References: PMID:10806111
Synonyms: unc-29(e1072) I; ccIs55 V.
Alternate IDs: WB-STRAIN:PJ1015, CGC_PJ1015
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc.
Proper citation: RRID:WB-STRAIN:WBStrain00030687 Copy
http://www.wormbase.org/db/get?name=WBStrain00030688
Source Database: WormBase (WB)
Affected Genes: WBGene00001207(egl-43)
Genomic Alteration: WBGene00001207(egl-43)
Availability: available
Source References: EMPTY
Synonyms: egl-43(n1079) II; ccIs55 V.
Alternate IDs: WB-STRAIN:PJ1017, CGC_PJ1017
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 25C.
Proper citation: RRID:WB-STRAIN:WBStrain00030688 Copy
http://www.wormbase.org/db/get?name=WBStrain00030609
Source Database: WormBase (WB)
Affected Genes: WBGene00004879(smg-1)
Genomic Alteration: WBGene00004879(smg-1)
Availability: available
Source References: PMID:31882874, PMID:32302543, PMID:37728486, PMID:37936921
Synonyms: smg-1(cc546) I.
Alternate IDs: WB-STRAIN:PD8120, CGC_PD8120
Notes: Made_by: Getz and Fire|"Reference WBPaper00058995 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype smg-1(cc546)"|"Supplementary_genotype smg-1(cc546) I"|"Temperature sensitive. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]"|"WBStrain mapped, WBPaper00059578 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00030609 Copy
http://www.wormbase.org/db/get?name=WBStrain00030608
Source Database: WormBase (WB)
Affected Genes: WBGene00004879(smg-1)
Genomic Alteration: WBGene00004879(smg-1)
Availability: available
Source References: EMPTY
Synonyms: smg-1(cc545) I.
Alternate IDs: WB-STRAIN:PD8119, CGC_PD8119
Notes: Made_by: Getz and Fire|"Temperature sensitive. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).]"
Proper citation: RRID:WB-STRAIN:WBStrain00030608 Copy
http://www.wormbase.org/db/get?name=WBStrain00030651
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:PF207
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00030651 Copy
http://www.wormbase.org/db/get?name=WBStrain00030658
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:PF214
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00030658 Copy
http://www.wormbase.org/db/get?name=WBStrain00030656
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:PF212
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00030656 Copy
http://www.wormbase.org/db/get?name=WBStrain00030653
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:PF209
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00030653 Copy
http://www.wormbase.org/db/get?name=WBStrain00030661
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:PF217
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00030661 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within Kravitz that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.