Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
QL402 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048588 | Caenorhabditis elegans | EMPTY | Generated from papers flagged positive during the last month for data type afp_strain/other_strain. | WB-STRAIN:WBStrain00048588 | WormBase (WB) | WB | unknown | PMID:33357442 | 2026-09-05 04:56:30 | 0 | |||||
|
SV2082 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048621 | Caenorhabditis elegans | EMPTY | Generated from papers flagged positive during the last month for data type afp_strain/other_strain. | WB-STRAIN:WBStrain00048621 | WormBase (WB) | WB | unknown | PMID:32494730 | 2026-09-05 04:56:31 | 0 | |||||
|
QL404 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048589 | Caenorhabditis elegans | EMPTY | Generated from papers flagged positive during the last month for data type afp_strain/other_strain. | WB-STRAIN:WBStrain00048589 | WormBase (WB) | WB | unknown | PMID:33357442 | 2026-09-05 04:56:30 | 0 | |||||
|
SV2105 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048623 | Caenorhabditis elegans | EMPTY | Generated from papers flagged positive during the last month for data type afp_strain/other_strain. | WB-STRAIN:WBStrain00048623 | WormBase (WB) | WB | unknown | PMID:32494730 | 2026-09-05 04:56:31 | 0 | |||||
|
SV2117 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048624 | Caenorhabditis elegans | EMPTY | Generated from papers flagged positive during the last month for data type afp_strain/other_strain. | WB-STRAIN:WBStrain00048624 | WormBase (WB) | WB | unknown | PMID:32494730 | 2026-09-05 04:56:31 | 0 | |||||
|
SV2122 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048625 | Caenorhabditis elegans | EMPTY | Generated from papers flagged positive during the last month for data type afp_strain/other_strain. | WB-STRAIN:WBStrain00048625 | WormBase (WB) | WB | unknown | PMID:32494730 | 2026-09-05 04:56:31 | 0 | |||||
|
ML1694 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048560 | Caenorhabditis elegans | EMPTY | Generated from papers flagged positive during the last month for data type afp_strain/other_strain. | WB-STRAIN:WBStrain00048560 | WormBase (WB) | WB | unknown | PMID:33238119 | 2026-09-05 04:56:30 | 0 | |||||
|
NVK233 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048562 | Caenorhabditis elegans | EMPTY | Generated from papers flagged positive during the last month for data type afp_strain/other_strain. | WB-STRAIN:WBStrain00048562 | WormBase (WB) | WB | unknown | PMID:32600387 | 2026-09-05 04:56:30 | 0 | |||||
|
LD1906 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048552 | Caenorhabditis elegans | EMPTY | Generated from papers flagged positive during the last month for data type afp_strain/other_strain. | WB-STRAIN:WBStrain00048552 | WormBase (WB) | WB | unknown | PMID:33658510 | 2026-09-05 04:56:30 | 0 | |||||
|
MAS91 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00048554 | Caenorhabditis elegans | EMPTY | Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"WBStrain provided so WBPaper00061495 paper added based on AFP_Strain data." | WB-STRAIN:WBStrain00048554 | WormBase (WB) | WB | unknown | PMID:32149606 PMID:38450962 |
2026-09-05 04:56:30 | 1 | |||||
|
MAS96 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048555 | Caenorhabditis elegans | EMPTY | Generated from papers flagged positive during the last month for data type afp_strain/other_strain. | WB-STRAIN:WBStrain00048555 | WormBase (WB) | WB | unknown | PMID:32149606 | 2026-09-05 04:56:30 | 0 | |||||
|
ML1659 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048558 | Caenorhabditis elegans | EMPTY | Generated from papers flagged positive during the last month for data type afp_strain/other_strain. | WB-STRAIN:WBStrain00048558 | WormBase (WB) | WB | unknown | PMID:33238119 | 2026-09-05 04:56:30 | 0 | |||||
|
PMD13 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048571 | Caenorhabditis elegans | EMPTY | Generated from papers flagged positive during the last month for data type afp_strain/other_strain. | WB-STRAIN:WBStrain00048571 | WormBase (WB) | WB | unknown | PMID:33674585 PMID:40118018 |
2026-09-05 04:56:30 | 0 | |||||
|
PMD60 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048573 | Caenorhabditis elegans | EMPTY | Generated from papers flagged positive during the last month for data type afp_strain/other_strain. | WB-STRAIN:WBStrain00048573 | WormBase (WB) | WB | unknown | PMID:33674585 | 2026-09-05 04:56:30 | 0 | |||||
|
SV1894 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048604 | Caenorhabditis elegans | EMPTY | Generated from papers flagged positive during the last month for data type afp_strain/other_strain. | WB-STRAIN:WBStrain00048604 | WormBase (WB) | WB | unknown | PMID:32494730 | 2026-09-05 04:56:31 | 0 | |||||
|
swsn-8(he273 he287 [LoxN exon 3 + LoxN last intron]) I; heSi208 V; heSi141 X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048606 | Caenorhabditis elegans | swsn-8(he273 he287 [LoxN exon 3 + LoxN last intron]) I; heSi208 V; heSi141 X. | Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. he273 he287 homozygotes are Egl since they cannot form a functioning vulva due to swsn-8 inactivated in the mesoderm lineage by hlh-8p::CRE expression. LoxN sites in the endogenous swsn-8 locus facilitate inducible knockout of swsn-8. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730" | WB-STRAIN:WBStrain00048606 | WormBase (WB) | WB | unknown | PMID:32494730 | 2026-09-05 04:56:31 | 0 | |||||
|
unc-119(ed3) III; mdf-2(lt4::loxP::Cbr-unc-119(+)::loxP) IV/nT1 [qIs51] (IV;V). Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048564 | Caenorhabditis elegans | unc-119(ed3) III; mdf-2(lt4::loxP::Cbr-unc-119(+)::loxP) IV/nT1 [qIs51] (IV;V). | CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.|"Generated from papers flagged positive during the last month for data type afp_strain/other_strain." | WBGene00003161(mdf-2)|WBGene00006843(unc-119) | WBGene00003161(mdf-2), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00048564 | WormBase (WB) | WB | available | PMID:31588029 | CGC_OD2174 | 2026-09-05 04:56:30 | 0 | ||
|
cyb-3(lt110) V/nT1 [qIs51] (IV;V). Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048566 | Caenorhabditis elegans | cyb-3(lt110) V/nT1 [qIs51] (IV;V). | CRISPR/Cas9 engineered deletion of cyb-3. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. gRNA sequences: tcaggtcgacattcttggcc & gttatgggtatgagagcatt Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.|"Generated from papers flagged positive during the last month for data type afp_strain/other_strain." | WBGene00000868(cyb-3) | WBGene00000868(cyb-3) | WB-STRAIN:WBStrain00048566 | WormBase (WB) | WB | available | PMID:31588029 | CGC_OD3737 | 2026-09-05 04:56:30 | 0 | ||
|
che-7(ot866[che-7::TagRFP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048568 | Caenorhabditis elegans | che-7(ot866[che-7::TagRFP]) V. | Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"tagRFP inserted into endogenous che-7 locus." | WBGene00000488(che-7) | WBGene00000488(che-7) | WB-STRAIN:WBStrain00048568 | WormBase (WB) | WB | available | PMID:32356725 | CGC_OH16372 | 2026-09-05 04:56:30 | 0 | ||
|
swsn-4(he268 he272 [LoxN start + LoxN intron 5]) IV; heSi208 V; heSi141 X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048602 | Caenorhabditis elegans | swsn-4(he268 he272 [LoxN start + LoxN intron 5]) IV; heSi208 V; heSi141 X. | Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. Egg laying defective. LoxN sites in the endogenous swsn-4 locus facilitate inducible knockout of swsn-4. he268 he272 homozygotes are Egl since they cannot form a functioning vulva due to swsn-4 inactivated in the mesoderm lineage by hlh-8p::CRE expression. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730" | WBGene00004204(swsn-4) | WBGene00004204(swsn-4) | WB-STRAIN:WBStrain00048602 | WormBase (WB) | WB | unknown | PMID:32494730 | 2026-09-05 04:56:30 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
