Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
RB809 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031522 | Caenorhabditis elegans | ptl-1(ok621) III. | F42G9.9a. Homozygous. Outer Left Sequence: CCTCCTACCACCCATCTGAA. Outer Right Sequence: CAACATGCTCAGGGAAGTCA. Inner Left Sequence: TGAACCGAAGCCTAAACCAG. Inner Right Sequence: CTGGAAATTTGTTGGGCAGT. Inner primer WT PCR product: 2452.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"Supplementary_genotype ptl-1 (ok621) III"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00004212(ptl-1) | WBGene00004212(ptl-1) | WB-STRAIN:WBStrain00031522 | WormBase (WB) | WB | available | PMID:37603562 | WB-STRAIN:RB809, CGC_RB809 | 2026-09-05 04:52:35 | 6 | ||
|
RB808 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031521 | Caenorhabditis elegans | D1022.3(ok620) II. | D1022.3, D1022.4. Homozygous. Outer Left Sequence: ACATGGCCGGTATTCTGGTA. Outer Right Sequence: TACGCAGACAACGTCAAACC. Inner Left Sequence: GGCGATGGACTACAACAGGT. Inner Right Sequence: CAGCTTTCCGAGGAATTACG. Inner primer WT PCR product: 2467.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00017022(D1022.3) | WBGene00017022(D1022.3) | WB-STRAIN:WBStrain00031521 | WormBase (WB) | WB | available | WB-STRAIN:RB808, CGC_RB808 | 2026-09-05 04:52:35 | 0 | |||
|
RB818 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031531 | Caenorhabditis elegans | hum-1(ok634) I. | F29D10.4. Homozygous. Outer Left Sequence: AGTGCATGCAAACAGCACTC. Outer Right Sequence: CAGTAAATACGCCGGTGGTT. Inner Left Sequence: CCAACCAGGGACTGAAGTGT. Inner Right Sequence: GTCAATGTTCAGCATGTCGG. Inner primer WT PCR product: 3054.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00002035(hum-1) | WBGene00002035(hum-1) | WB-STRAIN:WBStrain00031531 | WormBase (WB) | WB | available | WB-STRAIN:RB818, CGC_RB818 | 2026-09-05 04:52:35 | 1 | |||
|
RB817 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031530 | Caenorhabditis elegans | abt-4(ok633) | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y39D8C.1. Homozygous. Outer Left Sequence: ATGGACAGCGTGTCATACCA. Outer Right Sequence: TTTGGGTAAGTTGGGCTTTG. Inner Left Sequence: CGGCTCCGTCACTTCTATTC. Inner Right Sequence: GATCTCAAGAACCCCGACAA. Inner primer WT PCR product: 3226." | WBGene00000022(abt-4) | WBGene00000022(abt-4) | WB-STRAIN:WBStrain00031530 | WormBase (WB) | WB | available | PMID:38443452 | WB-STRAIN:RB817, CGC_RB817 | 2026-09-05 04:52:35 | 0 | ||
|
RB822 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031535 | Caenorhabditis elegans | dhs-6(ok637) II. | C17G10.8. Homozygous. Outer Left Sequence: CCATAGAGCGTTCACAGCAA. Outer Right Sequence: CTAACGTGTGGCTTTGGGAT. Inner Left Sequence: TATGTGCACCTTTACGGGGT. Inner Right Sequence: ACGCAATGCTGATGAAGTTG. Inner Primer WT PCR product: 3096. Deletion size: 924 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000970(dhs-6) | WBGene00000970(dhs-6) | WB-STRAIN:WBStrain00031535 | WormBase (WB) | WB | available | WB-STRAIN:RB822, CGC_RB822 | 2026-09-05 04:52:35 | 0 | |||
|
RB821 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031534 | Caenorhabditis elegans | clh-2(ok636) II. | B0491.8 Outer Left Sequence: AACAAATCTTCCCGTGCATC. Outer Right Sequence: ATCGATAGACCATTGGCTGG. Inner Left Sequence: GCTCAACTTCAGGGCAGACT. Inner Right Sequence: GTAGATATTGGCCATCGCGT. Inner Primer PCR Length: 2884. Estimated Deletion Size: about 1000 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000529(clh-2) | WBGene00000529(clh-2) | WB-STRAIN:WBStrain00031534 | WormBase (WB) | WB | available | WB-STRAIN:RB821, CGC_RB821 | 2026-09-05 04:52:35 | 0 | |||
|
RB820 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031533 | Caenorhabditis elegans | bmk-1(ok391) V. | F23B12.8 Homozygous. Outer Left Sequence: CGAGAACCTGCTTTTCAAGG. Outer Right Sequence: CAATCTTGTGCTACTGCCGA. Inner Left Sequence: ATTTGCTGCGAACCTTGACT. Inner Right Sequence: GCCGCGAATCATTGTATTTC. Inner Primer PCR Length: 2690. Estimated Deletion Size: about 800 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000257(bmk-1) | WBGene00000257(bmk-1) | WB-STRAIN:WBStrain00031533 | WormBase (WB) | WB | available | PMID:38302462 | WB-STRAIN:RB820, CGC_RB820 | 2026-09-05 04:52:35 | 0 | ||
|
RB819 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031532 | Caenorhabditis elegans | xbx-4(ok635) IV. | C23H5.3. Homozygous. Outer Left Sequence: TCAAACAAATTGCGAAGCAG. Outer Right Sequence: TGGGGTGCTGAAAATTTAGG. Inner Left Sequence: ATTCTGGGAGCCCAAGTTTT. Inner Right Sequence: GTGATGCTTCTCGGTCCAAT. Inner primer WT PCR product: 2596.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016025(xbx-4) | WBGene00016025(xbx-4) | WB-STRAIN:WBStrain00031532 | WormBase (WB) | WB | available | WB-STRAIN:RB819, CGC_RB819 | 2026-09-05 04:52:35 | 0 | |||
|
RB872 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031585 | Caenorhabditis elegans | R09E10(ok713) IV. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"R09E10. Homozygous. Outer Left Sequence: ATTTGCCGTCAAAACTGACC. Outer Right Sequence: TACATTGTTGCCCACTGCAT. Inner Left Sequence: TGCAGCTGATCGTTTCATTC. Inner Right Sequence: TGCAGGTGTGAAGTGGACTC. Inner primer WT PCR product: 3420."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00031585 | WormBase (WB) | WB | available | WB-STRAIN:RB872, CGC_RB872 | 2026-09-05 04:52:36 | 0 | |||||
|
RB871 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031584 | Caenorhabditis elegans | gly-13(ok712) X. | B0416.6. Homozygous. Outer Left Sequence: TGTTTCAAAACGCTCACTCG. Outer Right Sequence: TTCCATAACTGCAGTCGCAA. Inner Left Sequence: TTCGGTAAGAATGAAACCCG. Inner Right Sequence: TTCAAAACGGGAATCTGGAG. Inner primer WT PCR product: 3235.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001638(gly-13) | WBGene00001638(gly-13) | WB-STRAIN:WBStrain00031584 | WormBase (WB) | WB | available | WB-STRAIN:RB871, CGC_RB871 | 2026-09-05 04:52:36 | 0 | |||
|
RB870 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031583 | Caenorhabditis elegans | F39H12.4(ok711) X. | F39H12.4. Homozygous. Outer Left Sequence: GTTTCGTCGACTTTGCATCA. Outer Right Sequence: GCACTACACCTTCCGAGAGC. Inner Left Sequence: CCGATAGGGTTGCTTGATGT. Inner Right Sequence: GGTGCAACCGAAAGTTTGTT. Inner primer WT PCR product: 2828.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00018215(igcm-1) | WBGene00018215(igcm-1) | WB-STRAIN:WBStrain00031583 | WormBase (WB) | WB | available | WB-STRAIN:RB870, CGC_RB870 | 2026-09-05 04:52:36 | 0 | |||
|
RB869 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031582 | Caenorhabditis elegans | xnd-1(ok709). | C05D2.5. Homozygous. Outer Left Sequence: GAACCCATTGTTGCCAATCT. Outer Right Sequence: GAGGATCGTCATTTCCCTGA. Inner Left Sequence: TTTTCCACCAATATCCCCAA. Inner Right Sequence: TTGAAGCCCTTTTGTCAACC. Inner primer WT PCR product: 2810.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001514(xnd-1) | WBGene00001514(xnd-1) | WB-STRAIN:WBStrain00031582 | WormBase (WB) | WB | available | WB-STRAIN:RB869, CGC_RB869 | 2026-09-05 04:52:36 | 2 | |||
|
RB867 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031580 | Caenorhabditis elegans | haf-1(ok705) IV. | C30H6.6. Homozygous. Outer Left Sequence: CACCCCTGTCACAGACCTTT. Outer Right Sequence: CGCCAGAGAACAACAGATG. Inner Left Sequence: TGGGCACAAGTTTCATGGT. Inner Right Sequence: AATTTTCTCGCCCTCCAGAT. Inner primer WT PCR product: 2412.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001811(haf-1) | WBGene00001811(haf-1) | WB-STRAIN:WBStrain00031580 | WormBase (WB) | WB | available | WB-STRAIN:RB867, CGC_RB867 | 2026-09-05 04:52:36 | 0 | |||
|
RB792 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031505 | Caenorhabditis elegans | F09C12.2(ok582) II. | F09C12.2. Homozygous. Outer Left Sequence: ATGACCGTGGAGTGTGACAA. Outer Right Sequence: CGATCCCTCACTCGGATAAA. Inner Left Sequence: GGTTGCAGGGGTTCTGAATA. Inner Right Sequence: CTTGGCTCATTTTTGACGGT. Inner primer WT PCR product: 3078.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00017277(F09C12.2) | WBGene00017277(F09C12.2) | WB-STRAIN:WBStrain00031505 | WormBase (WB) | WB | available | WB-STRAIN:RB792, CGC_RB792 | 2026-09-05 04:52:35 | 0 | |||
|
RB791 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031504 | Caenorhabditis elegans | hsp-16.48(ok577) V. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T27E4.3, T27E4.8. Homozygous. Outer Left Sequence: TGGCATTCCTTCCTTATTGC. Outer Right Sequence: TGAGAAGCCGAGTAGCTGGT. Inner Left Sequence: GTAAGGCTTTCTGCCGTTTG. Inner Right Sequence: TGAGGGCCCTGTAGAAGTTG. Inner primer WT PCR product: 3051."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00061877 paper added based on AFP_Strain data." | WBGene00002019(hsp-16.48) | WBGene00002019(hsp-16.48) | WB-STRAIN:WBStrain00031504 | WormBase (WB) | WB | available | PMID:32009302 PMID:38987256 |
WB-STRAIN:RB791, CGC_RB791 | 2026-09-05 04:52:35 | 2 | ||
|
RB790 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031503 | Caenorhabditis elegans | atf-4(ok576) X. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T04C10.4. Homozygous. Outer Left Sequence: TGTCGCCAGTGTTGGAATAA. Outer Right Sequence: ACCGTGAAGATGGAGGTGAC. Inner Left Sequence: CGTGCGCTTCAAGTTCACTA. Inner Right Sequence: GCCAGAAGGCTACTTGGTTG. Inner primer WT PCR product: 2701."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000221(atf-4) | WBGene00000221(atf-4) | WB-STRAIN:WBStrain00031503 | WormBase (WB) | WB | available | PMID:38799567 PMID:39436952 |
WB-STRAIN:RB790, CGC_RB790 | 2026-09-05 04:52:35 | 4 | ||
|
RB875 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031588 | Caenorhabditis elegans | baz-2&ZK783.6(ok722) III. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK783.4 Homozygous. Outer Left Sequence: TCAGCTATCAAGCTCCGGTT. Outer Right Sequence: TGAACGTGCTCTTCATCGTC. Inner Left Sequence: CGTCATACGCCCAGAAGAAT. Inner Right Sequence: ACCAGTTGGTGAGAAATCCG. Inner Primer PCR Length: 3113. Estimated Deletion Size: about 1500 bp." | WBGene00001470(baz-2)|WBGene00044448(ZK783.6) | WBGene00001470(baz-2), WBGene00044448(ZK783.6) | WB-STRAIN:WBStrain00031588 | WormBase (WB) | WB | available | WB-STRAIN:RB875, CGC_RB875 | 2026-09-05 04:52:36 | 0 | |||
|
RB874 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031587 | Caenorhabditis elegans | M110.7(ok721) II. | M110.7. Homozygous. Outer Left Sequence: ACTTCATTCATCGCGAATCC. Outer Right Sequence: TTCTTGCACATCCAAGCAAC. Inner Left Sequence: GGAAAGTGTTTGAATGCGGT. Inner Right Sequence: AAGACTCACAGCTGCCTGGT. Inner primer WT PCR product: 2923.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010915(nte-2) | WBGene00010915(nte-2) | WB-STRAIN:WBStrain00031587 | WormBase (WB) | WB | available | WB-STRAIN:RB874, CGC_RB874 | 2026-09-05 04:52:36 | 0 | |||
|
RB794 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031507 | Caenorhabditis elegans | nhr-41(ok584) IV. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y77E11A.5. Homozygous. Outer Left Sequence: AGGCTCACCAAGAGCTTCAA. Outer Right Sequence:AGTAACCCGAGAATTTCGCA . Inner Left Sequence: TCAATTCGAAGCCCTTTCAC. Inner Right Sequence: CATTGATGAAACCTTCCCGT. Inner primer WT PCR product: 2853." | WBGene00022423(nhr-41) | WBGene00022423(nhr-41) | WB-STRAIN:WBStrain00031507 | WormBase (WB) | WB | available | WB-STRAIN:RB794, CGC_RB794 | 2026-09-05 04:52:35 | 0 | |||
|
RB880 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031593 | Caenorhabditis elegans | Y74C9A.4(ok727). | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y74C9A.4. Homozygous. Outer Left Sequence: CATCGATTGGATCAGCTTCA. Outer Right Sequence: GCGCCCAAAAATTACAAAAA. Inner Left Sequence: GCCTGATGGTTTACGGAGAA. Inner Right Sequence: TTGATTTTCAGACGTGCAGC. Inner Primer WT PCR Product: 3251. Deletion size: 696 bp." | WBGene00022278(rcor-1) | WBGene00022278(rcor-1) | WB-STRAIN:WBStrain00031593 | WormBase (WB) | WB | available | WB-STRAIN:RB880, CGC_RB880 | 2026-09-05 04:52:36 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
