Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
QS1 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031266 | Caenorhabditis elegans | chep-1(qr1). | Weak chemotaxis toward diacetyl. Possibly due to the weak chemotaxis toward diacetyl, qr1 were more preferentialy attracted by sodium acetate than WT in simultaneous two-spot presentation of sodium acetate and diacetyl. Mutagen used was Mos1 transposon, but it is not an insertion allele. | WBGene00045243(chep-1) | WBGene00045243(chep-1) | WB-STRAIN:WBStrain00031266 | WormBase (WB) | WB | available | WB-STRAIN:QS1, CGC_QS1 | 2026-09-05 04:52:32 | 0 | |||
|
QR109 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031262 | Caenorhabditis elegans | unc-119(ed3) III; vhIs24. | vhIs24 [vha-6p::GFP::rab-5 Q78L + Cbr-unc-119(+)]. Large endosomes in the intestinal cells. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00031262 | WormBase (WB) | WB | available | WB-STRAIN:QR109, CGC_QR109 | 2026-09-05 04:52:32 | 0 | |||
|
QR47 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031261 | Caenorhabditis elegans | unc-119(ed3) III; vhIs6. | vhIs6 [vha-6p::mCherry::tbc-2(R689K) + Cbr-unc-119(+)]. mCherry::TBC-2(R689K) is expressed in the intestine. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00031261 | WormBase (WB) | WB | available | WB-STRAIN:QR47, CGC_QR47 | 2026-09-05 04:52:32 | 0 | |||
|
QU10 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031268 | Caenorhabditis elegans | izEx5. | izEx5 [lgg-1p::GFP::lgg-1 + odr-1p::RFP]. Pick RFP+/GFP+ animals to maintain. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14. | WB-STRAIN:WBStrain00031268 | WormBase (WB) | WB | available | WB-STRAIN:QU10, CGC_QU10 | 2026-09-05 04:52:32 | 0 | |||||
|
QX1233 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031301 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90. | WB-STRAIN:WBStrain00031301 | WormBase (WB) | WB | available | PMID:22301316 PMID:33820969 PMID:38564369 |
WB-STRAIN:QX1233, CGC_QX1233 | 2026-09-05 04:52:32 | 0 | ||||
|
QV225 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031273 | Caenorhabditis elegans | skn-1(zj15) IV. | Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29.|"Reference WBPaper00059755 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype [skn-1(zj15) IV.]" | WBGene00004804(skn-1) | WBGene00004804(skn-1) | WB-STRAIN:WBStrain00031273 | WormBase (WB) | WB | available | PMID:32482227 PMID:32535316 PMID:31771413 PMID:33809299 PMID:36791646 PMID:37704756 PMID:38790689 |
WB-STRAIN:QV225, CGC_QV225 | 2026-09-05 04:52:32 | 7 | ||
|
QV224 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031272 | Caenorhabditis elegans | dvIs19 III; skn-1(zj15) IV. | dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29. | WBGene00004804(skn-1) | WBGene00004804(skn-1) | WB-STRAIN:WBStrain00031272 | WormBase (WB) | WB | available | WB-STRAIN:QV224, CGC_QV224 | 2026-09-05 04:52:32 | 0 | |||
|
QX1211 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031279 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90.|"Supplementary_genotype" | WB-STRAIN:WBStrain00031279 | WormBase (WB) | WB | available | PMID:30078564 PMID:33820969 PMID:37221008 PMID:37572357 PMID:37865119 PMID:38564369 |
WB-STRAIN:QX1211, CGC_QX1211 | 2026-09-05 04:52:32 | 1 | ||||
|
QX1213 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031281 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Isolated from soil underneath an orange-half staked out in the backyard of 363 Jersey St. for three days. The soil and orange bits were plated on OP50 on 27 Nov and on 29 Nov six young adult hermaphrodites were detected. Each was singled to found a line, QX1211-1216. | WB-STRAIN:WBStrain00031281 | WormBase (WB) | WB | unknown | PMID:33820969 | WB-STRAIN:QX1213 | 2026-09-05 04:52:32 | 0 | ||||
|
QX1212 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031280 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Isolated from soil underneath an orange-half staked out in the backyard of 363 Jersey St. for three days. The soil and orange bits were plated on OP50 on 27 Nov and on 29 Nov six young adult hermaphrodites were detected. Each was singled to found a line, QX1211-1216. | WB-STRAIN:WBStrain00031280 | WormBase (WB) | WB | unknown | PMID:33820969 PMID:38564369 |
WB-STRAIN:QX1212 | 2026-09-05 04:52:32 | 0 | ||||
|
RB578 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031364 | Caenorhabditis elegans | C53D5.5(ok311) I. | C53D5.5. Homozygous. Outer Left Sequence: ccagcttctagccgcataac. Outer Right Sequence: caggtctcgaaacgaccaat. Inner Left Sequence: cccgtttttcagctttgtgt. Inner Right Sequence: acgggcaatattttcggaat. Inner primer WT PCR product: 2904.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016906(C53D5.5) | WBGene00016906(C53D5.5) | WB-STRAIN:WBStrain00031364 | WormBase (WB) | WB | available | WB-STRAIN:RB578, CGC_RB578 | 2026-09-05 04:52:33 | 0 | |||
|
RB570 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031361 | Caenorhabditis elegans | srgp-1(ok300) IV. | F12F6.5. Homozygous. Outer Left Sequence: GATGTGAAGGCTGACAAGCA. Outer Right Sequence: TAACCCGTGCATTTGTTGAA. Inner Left Sequence: CTTCGAGGCCAATCATCAAT. Inner Right Sequence: GCCAAAACTATCATGGGCTG. Inner Primer PCR Length: 2904 bp. Deletion Size: 1406 bp. Deletion left flank: ttttattactttgttttatatttcaaaaac. Deletion right flank: atcaagtcgatcttcaaatcgatcaaaagc.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006406(srgp-1) | WBGene00006406(srgp-1) | WB-STRAIN:WBStrain00031361 | WormBase (WB) | WB | available | WB-STRAIN:RB570, CGC_RB570 | 2026-09-05 04:52:33 | 1 | |||
|
RB661 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031401 | Caenorhabditis elegans | Y1A5A.1(ok414) III. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y1A5A.1. Homozygous. Outer Left Sequence: aggaagcacagactgggaga. Outer Right Sequence: caaatgcttccgtttccatt. Inner Left Sequence: ctgctcgtgtgtgtgtgttg. Inner Right Sequence: tcgtagcattgatcgtcgtc. Inner primer WT PCR product: 2569." | WBGene00012379(Y1A5A.1) | WBGene00012379(Y1A5A.1) | WB-STRAIN:WBStrain00031401 | WormBase (WB) | WB | available | WB-STRAIN:RB661, CGC_RB661 | 2026-09-05 04:52:34 | 0 | |||
|
RB660 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031400 | Caenorhabditis elegans | arr-1(ok401) X. | F53H8.2. Homozygous. Outer Left Sequence: agttttatgccgctctcgaa. Outer Right Sequence: tcaattcgttccccactctc. Inner Left Sequence: caacttttccgccacataca. Inner Right Sequence: atggcggaagtttaccctct. Inner primer WT PCR product: 2402.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000195(arr-1) | WBGene00000195(arr-1) | WB-STRAIN:WBStrain00031400 | WormBase (WB) | WB | available | PMID:37310929 | WB-STRAIN:RB660, CGC_RB660 | 2026-09-05 04:52:34 | 0 | ||
|
RB622 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031374 | Caenorhabditis elegans | fzr-1(ok380) II. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK1307.6. Superficially wild type." | WBGene00001510(fzr-1) | WBGene00001510(fzr-1) | WB-STRAIN:WBStrain00031374 | WormBase (WB) | WB | available | WB-STRAIN:RB622, CGC_RB622 | 2026-09-05 04:52:33 | 0 | |||
|
RB608 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031372 | Caenorhabditis elegans | tag-96(ok336) IV. | M01D7.4. Superficially wild type.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006461(tag-96) | WBGene00006461(tag-96) | WB-STRAIN:WBStrain00031372 | WormBase (WB) | WB | available | WB-STRAIN:RB608, CGC_RB608 | 2026-09-05 04:52:33 | 0 | |||
|
RB607 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031371 | Caenorhabditis elegans | nlp-12(ok335) I. | M01D7.5. Superficially wild type.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060969 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data." | WBGene00003750(nlp-12) | WBGene00003750(nlp-12) | WB-STRAIN:WBStrain00031371 | WormBase (WB) | WB | available | PMID:33524034 | WB-STRAIN:RB607, CGC_RB607 | 2026-09-05 04:52:33 | 3 | ||
|
RB631 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031378 | Caenorhabditis elegans | srp-2(ok350) V. | C05E4.1. Homozygous. Outer Left Sequence: CTTACTGCCGCAAATCTTCGCGA . Outer Right Sequence: GTTGCGTAGAACTTTCGAGCCTA. Inner Left Sequence: CACTTTATGACGGCACAAAAAAG. Inner Right Sequence: GTGTTATTCTAATTGTCTCGGAAC. Inner primer WT PCR product: 2719.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00005643(srp-2) | WBGene00005643(srp-2) | WB-STRAIN:WBStrain00031378 | WormBase (WB) | WB | available | WB-STRAIN:RB631, CGC_RB631 | 2026-09-05 04:52:33 | 0 | |||
|
RB634 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031380 | Caenorhabditis elegans | C43F9.6(ok356) IV. | C43F9.6. Homozygous. Outer Left Sequence: cggtgctgcattgtgtctat. Outer Right Sequence: tcgtactgcttgtttgcgtc. Inner Left Sequence: aaatcgttcgaaattgtggg. Inner Right Sequence: tctcgacagacggtgagttg. Inner primer WT PCR product: 2548.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008074(nkb-2) | WBGene00008074(nkb-2) | WB-STRAIN:WBStrain00031380 | WormBase (WB) | WB | available | WB-STRAIN:RB634, CGC_RB634 | 2026-09-05 04:52:33 | 0 | |||
|
RB511 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031342 | Caenorhabditis elegans | T05A7.11&fut-5(ok242) II. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T05A7.11, T05A7.10. Homozygous. Outer Left Sequence: CAACATGTTCGGGAGTGATG. Outer Right Sequence: GCCACTCCATTTTTCGATGT. Inner Left Sequence: ACAGCAATGTCAAGCATTCG. Inner Right Sequence: ACGGGATATCAATGAGACGG. Inner Primer PCR Length: 3185 bp. Deletion Size: 1882 bp. Deletion left flank: TCGTAACTCCTTCATCATCTGGTTTCAAAT. Deletion right flank: ATGGAATATCATATCGTCGATTTTTATTGA."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00043986(fut-5)|WBGene00044383(T05A7.11) | WBGene00043986(fut-5), WBGene00044383(T05A7.11) | WB-STRAIN:WBStrain00031342 | WormBase (WB) | WB | available | WB-STRAIN:RB511, CGC_RB511 | 2026-09-05 04:52:33 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
