Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Y48A5A.3(gk5477[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047659 | Caenorhabditis elegans | Y48A5A.3(gk5477[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. | Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 562 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAATAATCAATAAAGTATCGATTTTTCCG; Right flanking sequence: TGAAAAAACATTAAAAATAGCGGTTATTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047659 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:18 | 0 | ||||
|
col-35(gk5465[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047653 | Caenorhabditis elegans | col-35(gk5465[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 1640 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTGCCATCTCAATATCTTTTTTTGCCACCG; Right flanking sequence: GAGTGATGTTTTCTTCCATTTCCACTTACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00000612(col-35)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000612(col-35), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047653 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:18 | 0 | ||||
|
T21B4.3(gk5437[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047639 | Caenorhabditis elegans | T21B4.3(gk5437[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 854 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGACATAGGATTTCATCGATCACAAGACCG; Right flanking sequence: GGGAGTGTAGAAGTGAAGTCAATTGATCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047639 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:18 | 0 | ||||
|
C32E8.5(gk5561[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047692 | Caenorhabditis elegans | C32E8.5(gk5561[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. | Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 988 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CACGAAAACGATGGGAAGAGATAGCCCGCG; Right flanking sequence: GAAGGAGAAGATGTTAAAAAGGAAGAATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047692 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:19 | 0 | ||||
|
C28C12.4(gk5565[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047693 | Caenorhabditis elegans | C28C12.4(gk5565[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 879 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAGGATGAGAGAGTGAGAGAGAGTAGGTAT; Right flanking sequence: AGCATGAACGAGTCTTCTGATGTCAACGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047693 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:19 | 0 | ||||
|
wbmIs72 III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047725 | Caenorhabditis elegans | wbmIs72 III. | Made_by: Carlos G Silva-Garca|"wbmIs72 [pie-1p::3XFLAG::GFP::unc-54 3'UTR *wbmIs60] (III:7007600). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs72 exhibits germline-specific GFP expression driven the pie-1 promoter. Derived from parental strain WBM1119 by CRISPR-mediated insertion of GFP downstream of tissue-specific pie-1 promoter inserted as a single copy into the C. elegans genome (wbmIs60). Reference: Silva-Garca CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198." | WB-STRAIN:WBStrain00047725 | WormBase (WB) | WB | unknown | PMID:39572679 | 2026-09-05 04:56:19 | 0 | |||||
|
dlc-3(gk5531[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047683 | Caenorhabditis elegans | dlc-3(gk5531[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. | Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4205 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCAAAGACAAAAGCTTGACACCAACCATTT; Right flanking sequence: ATTGGTTTTCAAAAAAAAAGGAGATATATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00012424(dlc-3) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00012424(dlc-3) | WB-STRAIN:WBStrain00047683 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:19 | 0 | ||||
|
C08F8.2(gk5423[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC9 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047684 | Caenorhabditis elegans | C08F8.2(gk5423[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC9 IV. | Homozygous lethal or sterile deletion balanced by tmC9. Deletion of 1365 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous tmC9 is non-GFP Mec-3 Unc-31. Left flanking sequence: TATCAAATATTACAGATGAGAAGGGCGTCT; Right flanking sequence: CGTACTCTCTGGCGCGAAAAGCCGATTTAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047684 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:19 | 0 | ||||
|
ZC477.4(gk5533[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047685 | Caenorhabditis elegans | ZC477.4(gk5533[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. | Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1278 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTCAGCTTTCCTGAAAATACATGTACAC; Right flanking sequence: AATGGCCTTGGGCGTGAGCAAAAAAAAACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047685 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:19 | 0 | ||||
|
atln-1(gk5537[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00047686 | Caenorhabditis elegans | atln-1(gk5537[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. | Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4161 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATTCTCCATTATCCGGATTCTCGTGGCGT; Right flanking sequence: TGGAACGGTTGGAATCTGATTTGCAGGTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021868(atln-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021868(atln-1) | WB-STRAIN:WBStrain00047686 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:19 | 1 | ||||
|
eif-6(gk5538[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047687 | Caenorhabditis elegans | eif-6(gk5538[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. | Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 977 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATCAATTAATTTTCAAAAAAAATTCCAGTT; Right flanking sequence: TGTCCGTCGTCGAATCGATCTTCAAGCTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00001234(eif-6)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001234(eif-6), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047687 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:19 | 0 | ||||
|
pbs-2(gk5540[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047688 | Caenorhabditis elegans | pbs-2(gk5540[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. | Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 960 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CATGGACTCGACGACGTCGTACTTGTAGGT; Right flanking sequence: TGATTTTCTGCAGATAACCTATTCAATAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00003948(pbs-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00003948(pbs-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047688 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:19 | 0 | ||||
|
unc-119(ed3) III; czIs110. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047721 | Caenorhabditis elegans | unc-119(ed3) III; czIs110. | czIs110 [mex-5p::GFP::KDEL::pie-1 3UTR + unc-119(+)]. GFP::KDEL is a marker of the luminal ER in the embryo. Reference: Lee et al., J Cell Biol. 2016 Sep 12;214(6):665-76. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00047721 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:19 | 0 | ||||
|
wbmIs63 I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047722 | Caenorhabditis elegans | wbmIs63 I. | Made_by: Carlos G Silva-Garca and Sneha Dutta|"wbmIs63 [myo-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs61] (I:2851000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs63 exhibits muscle-specific wrmScarlet expression driven the myo-3 promoter. Derived from parental strain WBM1126 by CRISPR-mediated insertion of wrmScarlet downstream of tissue-specific myo-3 promoter inserted as a single copy into the C. elegans genome (wbmIs61). Reference: Silva-Garca CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198."|"[2020-06-08T12:43:38.134Z WBPerson1983] New Strain: Added via the UI as the api triggering search error" | WB-STRAIN:WBStrain00047722 | WormBase (WB) | WB | unknown | PMID:39572679 | 2026-09-05 04:56:19 | 0 | |||||
|
Pf53f4.13::GFP Posm-10::mCherry(yadIs48) II Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047736 | Caenorhabditis elegans | Pf53f4.13::GFP Posm-10::mCherry(yadIs48) II | Imported from supporting material | WB-STRAIN:WBStrain00047736 | WormBase (WB) | WB | unknown | PMID:32209461 PMID:33211005 |
2026-09-05 04:56:19 | 0 | |||||
|
erd-2.2(gk5585[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047696 | Caenorhabditis elegans | erd-2.2(gk5585[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 1316 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTAGGGTCATCATGAACATCTTCCGTAT; Right flanking sequence: ATATCCATTTATTCAGCTTTTTAAAATAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047696 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:19 | 0 | ||||
|
wIs51 V; hbl-1(ma354) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047697 | Caenorhabditis elegans | wIs51 V; hbl-1(ma354) X. | wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111. | WBGene00001824(hbl-1) | WBGene00001824(hbl-1) | WB-STRAIN:WBStrain00047697 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:19 | 0 | ||||
|
(GA3) nsIs180 (Phlh17::recCaspase-3, Punc-122::GFP) Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047731 | Caenorhabditis elegans | (GA3) nsIs180 (Phlh17::recCaspase-3, Punc-122::GFP) | [2020-06-08T16:10:36.599Z WBPerson712] New Strain: WBPaper00059734 OS3549 (GA3) nsIs180 (Phlh17::recCaspase-3, Punc-122::GFP) | WB-STRAIN:WBStrain00047731 | WormBase (WB) | WB | unknown | PMID:32550520 | 2026-09-05 04:56:19 | 0 | |||||
|
maIs105 V; hbl-1(ma430[hbl-1::mScarlet-I]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047699 | Caenorhabditis elegans | maIs105 V; hbl-1(ma430[hbl-1::mScarlet-I]) X. | maIs105 [col-19::GFP] V. hbl-1(ma430) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1. Reference: Ilbay O & Ambros V. Curr Biol. 2019 Jun 3;29(11):1735-1745.e4.|"Reference WBPaper00056761 added based on published strain data identified by Textpresso literature search." | WBGene00001824(hbl-1) | WBGene00001824(hbl-1) | WB-STRAIN:WBStrain00047699 | WormBase (WB) | WB | unknown | PMID:31104929 | 2026-09-05 04:56:19 | 0 | |||
|
testOS3537 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047732 | Caenorhabditis elegans | EMPTY | [2020-06-09T00:25:40.11Z WBPerson1823] Kill Strain: Sorry, made by mistake | WB-STRAIN:WBStrain00047732 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:19 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
