Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search
Reset search
On page 101 showing 2001 ~ 2020 out of 64,152 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00047567

Source Database: WormBase (WB)
Affected Genes: WBGene00007218(C01A2.6)|WBGene00017775(F25B5.3)
Genomic Alteration: WBGene00007218(C01A2.6), WBGene00017775(F25B5.3)
Availability: unknown
Source References: EMPTY
Synonyms: C01A2.6(gk5192) I; F25B5.3(gk5193) III.
Notes: Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5192 mutation is G->A, flanking sequences TCCAAGCAAGGCACAAATTCTTGAAGCTTG and GAAAATGGAGCCGAACCTTGGCAATCTACC. The gk5193 mutation is C->T, flanking sequences AGACGATTCGAAAGTCGACAATCAATCTTA and AATTGCGAAGTAAGTGAAAGTGAGAACTTT.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047567 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047602

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: E04F6.15(gk5328[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II.
Notes: Homozygous viable. Deletion of 1646 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTCAGGTACCAATTTTTTGGAACCCGAAA; Right flanking sequence: ACCATCAGCAACCATTCTGAAAATGAAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047602 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047580

Source Database: WormBase (WB)
Affected Genes: WBGene00009090(fipr-3)|WBGene00019576(lido-5)
Genomic Alteration: WBGene00009090(fipr-3), WBGene00019576(lido-5)
Availability: unknown
Source References: EMPTY
Synonyms: fipr-3(gk5263) K09E3.5(gk5264) X.
Notes: Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5263 mutation is G->A, flanking sequences TTTTTCGTATTTTCAATTTCCAATGTTTCA and CCTTCTTTGTGTCCTTGCCTTGGTCATGTG. The gk5264 mutation is G->A, flanking sequences ATCTTCTTACCTTTGCTCCTTTCGGAGCTT and ATCTTCCCAGCTGATTTCCCTGGCCATAGA.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047580 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047581

Source Database: WormBase (WB)
Affected Genes: WBGene00016413(C34F11.1)|WBGene00021014(pid-4)
Genomic Alteration: WBGene00016413(C34F11.1), WBGene00021014(pid-4)
Availability: unknown
Source References: EMPTY
Synonyms: W03G9.2(gk5265) I; C34F11.1(gk5266) II.
Notes: Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5265 mutation is G->A, flanking sequences GAAATGACCGCCGAACTGAAGAAGTTAAAG and TGATATATACAACAATGAACAATCACTAAT. The gk5266 mutation is C->T, flanking sequences TCAGGCTCATGGCGAGCTCTTCCAGTGGCA and AAGGCGGTTCCTCACATATTCGTATCTGGC.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047581 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047615

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: F59E12.1(gk5356[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II.
Notes: Homozygous viable. Deletion of 1652 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ACTCTTGTTCTTCCTCCAACCAAGCCTCCC; Right flanking sequence: TTGGGTGAAGCAACATACGATCAAGGAGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047615 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047617

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: F46B3.7(gk5359[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V.
Notes: Homozygous viable. Deletion of 319 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TATCCAGTATCAAATTGAGGTTTGGTTCCA; Right flanking sequence: CTTGGGTTGGAATACAGGCAACAATAGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047617 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047618

Source Database: WormBase (WB)
Affected Genes: WBGene00000624(col-47)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000624(col-47), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: col-47(gk5365[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I.
Notes: Homozygous viable. Deletion of 2423 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TATTTCCAGAGAAGTTGGAAGTGTAGTCTT; Right flanking sequence: ACATTAAGGAGGAGCACAAAAAACACAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047618 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047619

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00020693(lron-8)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00020693(lron-8)
Availability: unknown
Source References: EMPTY
Synonyms: lron-8(gk5366[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I.
Notes: Homozygous viable. Deletion of 4771 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTTCTTCCTCCCACCGCCAGCCAGCCTGCT; Right flanking sequence: TTTGGGCATTGGGGGAAATCTTGGGCAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047619 Copy   

    • RRID:WB-STRAIN:WBStrain00047575

http://www.wormbase.org/db/get?name=WBStrain00047575

Source Database: WormBase (WB)
Affected Genes: WBGene00014235(ZK1225.1)
Genomic Alteration: WBGene00014235(ZK1225.1)
Availability: unknown
Source References: EMPTY
Synonyms: ZK1225.1(gk5216) I.
Notes: Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5216 mutation is C->T, flanking sequences AAATACACTCTGGAATCATACGCATCAATT and GAAGATATTATCCTACCAACAAGTTTATTA.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047575 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047576

Source Database: WormBase (WB)
Affected Genes: WBGene00017935(srbc-70)|WBGene00018353(fbxa-182)
Genomic Alteration: WBGene00017935(srbc-70), WBGene00018353(fbxa-182)
Availability: unknown
Source References: EMPTY
Synonyms: fbxa-182(gk5217) II; srbc-70(gk5218) IV.
Notes: Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5217 mutation is C->T, flanking sequences GCTGATGCGGACATCCAACTTAGTTAAAAT and CATTCATTTGTGGCTTGACATAAATTATAT. The gk5218 mutation is C->T, flanking sequences GTGATCAGTTCTATTTTTGGTGCAGAACTT and CAGACGAAAAGTCGAATGGCAAGAACTGCT.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047576 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047579

Source Database: WormBase (WB)
Affected Genes: WBGene00014998(AH9.1)|WBGene00019554(K09C4.10)
Genomic Alteration: WBGene00014998(AH9.1), WBGene00019554(K09C4.10)
Availability: unknown
Source References: EMPTY
Synonyms: AH9.1(gk5243) K09C4.10(gk5244) X.
Notes: Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5243 mutation is C->T, flanking sequences TTCAGTCCGACTGTTTTGTGATGGCTGTCT and CAGAACCAATTACGTTTGTCAATTTTCCGC. The gk5244 mutation is C->A, flanking sequences TGTCTGATCCTTTCTCAATAGTTCCATCCT and GCGCTTTTCAGCAATATGATTTTCAGATCC.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047579 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047613

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: gkDf72[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] II.
Notes: Homozygous viable. Deletion of 20792 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTCATACTTTATGGAACTGTGTTCCCGCGC; Right flanking sequence: TAGAGCATCCCAATTGCCTCGATTCCATAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047613 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047670

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00003797(npp-11)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00003797(npp-11), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: npp-11(gk5507[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I.
Notes: Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 751 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CCAGATCAAATGTTTGGAGGATCTGCACCA; Right flanking sequence: CCATCAGCTTCTGCAGCTGCTTCTTCATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047670 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047669

Source Database: WormBase (WB)
Affected Genes: WBGene00000286(cal-2)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000286(cal-2), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: cal-2(gk5504[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II.
Notes: Homozygous viable. Deletion of 1512 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CGTTCGGTTGTTGGTGAAGCTGCTGAGCCA; Right flanking sequence: GATGAGAGCGAGTAAGCTCCGTTGGAATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047669 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047703

Source Database: WormBase (WB)
Affected Genes: WBGene00000908(daf-12)
Genomic Alteration: WBGene00000908(daf-12)
Availability: unknown
Source References: EMPTY
Synonyms: maIs105 V; daf-12(ma498[daf-12::mScarlet-I]) X.
Notes: maIs105 [col-19p::GFP] V. mScarlet-I tag inserted at C-terminus of endogenous daf-12 locus through CRISPR/Cas9-engineering. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.

Proper citation: RRID:WB-STRAIN:WBStrain00047703 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047704

Source Database: WormBase (WB)
Affected Genes: WBGene00003083(lst-1)
Genomic Alteration: WBGene00003083(lst-1)
Availability: unknown
Source References: EMPTY
Synonyms: lst-1(am302[3xFLAG::lst-1]) I.
Notes: Non-Glp; remains fertile even with sygl-1(RNAi). Endogenous lst-1 locus tagged with a 3xFLAG N-terminally. Visible in cytoplasm of 5-6 cell diameters of distal germline in young adults. Reference: Kocsisova Z, et al. Development. 2019 Apr 23;146(8).

Proper citation: RRID:WB-STRAIN:WBStrain00047704 Copy   

    • RRID:WB-STRAIN:WBStrain00047705

http://www.wormbase.org/db/get?name=WBStrain00047705

Source Database: WormBase (WB)
Affected Genes: WBGene00012104(sygl-1)
Genomic Alteration: WBGene00012104(sygl-1)
Availability: unknown
Source References: PMID:34555015
Synonyms: sygl-1(am307) I
Notes: Non-Glp; remains fertile even with lst-1(RNAi). Endogenous sygl-1 locus tagged with a 3xFLAG N-terminally. Visible in cytoplasm of 10-12 cell diameters of distal germline in young adults. Reference: Kocsisova Z, et al. Development. 2019 Apr 23;146(8).

Proper citation: RRID:WB-STRAIN:WBStrain00047705 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047707

Source Database: WormBase (WB)
Affected Genes: WBGene00006803(unc-70)
Genomic Alteration: WBGene00006803(unc-70)
Availability: unknown
Source References: EMPTY
Synonyms: unc-70(s1502) V; oxIs12 X.
Notes: oxIs12 [unc-47p::GFP + lin-15(+)]. Unc. Reference: Hammarlund M, et al. J Cell Biol. 2000 May 15;149(4):931-42. [NOTE: this strain grows very slowly and will take longer than usual to prepare for shipping.]

Proper citation: RRID:WB-STRAIN:WBStrain00047707 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047708

Source Database: WormBase (WB)
Affected Genes: WBGene00001332(eri-1)|WBGene00003004(lin-15)|WBGene00004323(rde-1)|WBGene00023497(lin-15B)
Genomic Alteration: WBGene00001332(eri-1), WBGene00003004(lin-15), WBGene00004323(rde-1), WBGene00023497(lin-15B)
Availability: unknown
Source References: EMPTY
Synonyms: eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X.
Notes: Made_by: Chris Firnhaber|"Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921."

Proper citation: RRID:WB-STRAIN:WBStrain00047708 Copy   

    • RRID:WB-STRAIN:WBStrain00047709

http://www.wormbase.org/db/get?name=WBStrain00047709

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37910615
Synonyms: wpIs14 X.
Notes: Mutagen:UV/TMP|"Supplementary_genotype wpIs14 [unc-17p::KillerRed +unc-122p::GFP] X"|"wpIs14 [unc-17p::KillerRed + unc-122p::GFP] X. X-Linked based on out-cross data. KillerRed expression in acetylcholine neurons. KillerRed is a red fluorescent protein and photosensitizer that efficiently generates reactive oxygen species (ROS) when activated by light. Reference: Williams DC, et al. Cell Rep. 2013 Oct 31;5(2):553-63."

Proper citation: RRID:WB-STRAIN:WBStrain00047709 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. Kravitz Dataset1 Resources

    Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within Kravitz that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).

Recent News Entries

Mouse 1

Mouse 2

Mouse 3

Contact Us

E [email protected]

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch