Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:gentamicin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

790 Results - per page

Show More Columns | Download 790 Result(s)

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pUAS-Luc
 
Resource Report
Resource Website 		RRID:Addgene_21604 UAS-hsp70 luciferase Gentamicin PMID:19481053 Backbone Marker:Stratagene; Backbone Size:3415; Vector Backbone:pBluescript SK(-); Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:15:37 0
pDON207 NSP3 K977Q
 
Resource Report
Resource Website 		RRID:Addgene_180057 SARS-CoV-2 NSP3 K977Q SARS-CoV-2 Gentamicin PMID:34709727 Vector Backbone:pDON207; Vector Types:Mammalian Expression; Bacterial Resistance:Gentamicin NSP3 K977Q 2026-09-19 02:14:51 0
pLX-TRV1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_180515 Tobacco rattle virus RNA1 Gentamicin PMID:35332696 Vector Backbone:pLX-Z4; Vector Types:Plant Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:14:54 1
pACEBac1-ZZ-TEV-MZT2-3C-mEGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_178074 MZT2A Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:14:39 3
pACEBac1-GCP5
 
Resource Report
Resource Website 		RRID:Addgene_178071 GCP5 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:14:39 0
pACEBac1-GCP6
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_178072 GCP6 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:14:39 1
pACEBac1-gamma-tubulin(N229A)-TEV-His6
 
Resource Report
Resource Website 		RRID:Addgene_178077 gamma-tubulin with an N229A point mutation Homo sapiens Gentamicin PMID:33496729 Primers used to generate pACEBac1-gamma-tubulin(N229A)-TEV-His6 via site-directed mutagenesis were CCCATCCTTCTCCCAGATCGCCCAGCTGGTGTCTACCATCATGTC and GACATGATGGTAGACACCAGCTGGGCGATCTGGGAGAAGGATGGG Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Changed Asparagine 229 to Alanine 2026-09-19 02:14:39 0
pACEBac1-MZT1
 
Resource Report
Resource Website 		RRID:Addgene_178075 MZT1 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:14:39 0
pACEBac1-beta-actin
 
Resource Report
Resource Website 		RRID:Addgene_178076 beta-actin Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:14:39 0
pACEBac1-gamma-tubulin-TEV-His6
 
Resource Report
Resource Website 		RRID:Addgene_178067 gamma-tubulin Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:14:39 0
BASIC_SEVA_67.10
 
Resource Report
Resource Website 		RRID:Addgene_178940 mScarlet counter-selection cassette Synthetic Gentamicin PMID:36381610 Cloning method: BASIC DNA assembly . Please visit https://www.biorxiv.org/content/10.1101/2022.01.06.446575v2 for bioRxiv preprint. Backbone Size:2607; Vector Backbone:BASIC_SEVA_67.10; Vector Types:Synthetic Biology; Bacterial Resistance:Gentamicin 2026-09-19 02:14:46 0
pRU1103
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_14467 lacZ E.coli Gentamicin PMID:16207908 Use gentamicin at 10 ug/mL. Backbone Size:4500; Vector Backbone:pbbr; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:10:23 1
pRU1098
 
Resource Report
Resource Website 		RRID:Addgene_14463 unstable gfp-mut3.1 LAA Aequorea Gentamicin PMID:16207908 Use gentamicin at 10 ug/mL. Backbone Size:4500; Vector Backbone:pbbr; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:10:23 0
pRU1144
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_14471 mRFP1 Discoma Gentamicin PMID:16207908 Use gentamicin at 10 ug/mL. Backbone Size:4500; Vector Backbone:pbbr; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:10:23 1
pOmnibac_ZZ_linker_ybbR_MAP7
 
Resource Report
Resource Website 		RRID:Addgene_159718 MAP7 (Microtubule Associated Protein 7) Homo sapiens Gentamicin PMID:35050657 Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:12:07 0
pOmnibac_ZZ_linker_K560_GFP_SNAP
 
Resource Report
Resource Website 		RRID:Addgene_159720 KIF5B (only amino acids 1-560), K560 Homo sapiens Gentamicin PMID:35050657 Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Only amino acids 1-560 2026-09-19 02:12:07 0
pOmnibac_ZZ_linker_K490_GFP_SNAP
 
Resource Report
Resource Website 		RRID:Addgene_159721 KIF5B (only amino acids 1-490), K490 Homo sapiens Gentamicin PMID:35050657 Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Only amino acids (1-490) 2026-09-19 02:12:07 0
pOmnibac_ZZ_linker_ybbR_MAP7_N
 
Resource Report
Resource Website 		RRID:Addgene_159728 MAP7 (only amino acids 1-316)(includes MTBD and P123 domains) Homo sapiens Gentamicin PMID:35050657 Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:12:07 0
pOmnibac_ZZ_linker_K963_GFP_SNAP
 
Resource Report
Resource Website 		RRID:Addgene_159727 KIF5B (full length, 1-963 amino acids), K963 Homo sapiens Gentamicin PMID:35050657 Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:12:07 0
64 pCOLI_G2
 
Resource Report
Resource Website 		RRID:Addgene_160206 Gentamicin PMID:32955754 Vector Backbone:pST50Trc; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:12:11 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Kravitz Dataset1 Resources

    Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).

Recent News Entries

Mouse 1

Mouse 2

Mouse 3

Contact Us

E [email protected]

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch