Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: RD114 retrovirus
Genetic Insert: Anti-RD114 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:3431; Vector Backbone:pFUSEss; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:31702531
Proper citation: RRID:Addgene_110555 Copy
Species: Other
Genetic Insert: lacIq-Ptac
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Backbone Size:4569; Vector Backbone:pUC18T-miniTn7T-gm; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27613678
Proper citation: RRID:Addgene_110558 Copy
Species: Other
Genetic Insert: rhaSR-PrhaBAD
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Backbone Size:4569; Vector Backbone:pUC18T-miniTn7T-gm; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27613678
Proper citation: RRID:Addgene_110559 Copy
Species: E.coli
Genetic Insert: ecDHFR
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5493; Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24977791
Proper citation: RRID:Addgene_110541 Copy
Species: E.coli
Genetic Insert: ecDHFR
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5493; Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24977791
Proper citation: RRID:Addgene_110542 Copy
Species: Mus musculus
Genetic Insert: Grg1-S
Vector Backbone Description: Backbone Marker:Roche Molecular Biochemicals; Backbone Size:5400; Vector Backbone:pMH; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12359720
Proper citation: RRID:Addgene_11064 Copy
Species: Homo sapiens
Genetic Insert: Rtf1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15632063
Comments: Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CCCAAGCTTATGAAGAAACAGGCCAACA 3' and 5' CCGCTCGAGAATAAGCCCTCGTCGTTT 3'
Proper citation: RRID:Addgene_11060 Copy
Species: deleted foamy virus
Genetic Insert: EGFP, FV LTRs
Vector Backbone Description: Backbone Marker:Stratagene, La Jolla, CA; Backbone Size:5787; Vector Backbone:pBluescript II KS+; Vector Types:qPCR control for titering foamy virus; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18209733
Proper citation: RRID:Addgene_110549 Copy
Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Backbone Marker:Novagen/Agilent; Backbone Size:2412; Vector Backbone:pACYC; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: pIM2432
Proper citation: RRID:Addgene_110547 Copy
Species: bacteria
Genetic Insert: bacterial luciferase
Vector Backbone Description: Backbone Size:0; Vector Backbone:unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7984243
Comments: His as a selectable marker
Proper citation: RRID:Addgene_1106 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: NAB3
Vector Backbone Description: Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22564898
Proper citation: RRID:Addgene_110535 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: NAB3
Vector Backbone Description: Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22564898
Proper citation: RRID:Addgene_110533 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: NAB3
Vector Backbone Description: Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26954508
Proper citation: RRID:Addgene_110538 Copy
Vector Backbone Description: Vector Backbone:pAW42; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26886063
Proper citation: RRID:Addgene_110539 Copy
Species: Synthetic
Genetic Insert: rpoC
Vector Backbone Description: Vector Backbone:ColE1; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29608282
Proper citation: RRID:Addgene_110592 Copy
Species: Synthetic
Genetic Insert: mRFP dropout (RSF1010 origin)
Vector Backbone Description: Vector Backbone:RSF1010; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29608282
Proper citation: RRID:Addgene_110597 Copy
Species: Synthetic
Genetic Insert: cfSBFP2
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:EGFP-N1; Vector Types:; Bacterial Resistance:Kanamycin
Comments: Please note that although the sequencing software identifies the protein as a mEmerald variant, we have confirmed the the sequence is cfSBFP2 (C48S/C70M).
Proper citation: RRID:Addgene_110633 Copy
Species: Synthetic
Genetic Insert: mRFP dropout (RSF1010 origin)
Vector Backbone Description: Vector Backbone:RSF1010; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29608282
Proper citation: RRID:Addgene_110598 Copy
Species: Synthetic
Genetic Insert: cfSYFP2-N
Vector Backbone Description: Vector Backbone:SYFP2-N; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Please note that although the sequencing software identifies the protein as a mEmerald/Topaz YFP variant, we have confirmed the the sequence is SYFP2 (C48S/C70M).
Proper citation: RRID:Addgene_110631 Copy
Species: Homo sapiens
Genetic Insert: PCDHB10
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_110516 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within Kravitz that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
