Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 67 showing 1321 ~ 1340 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_196709

    This resource has 1+ mentions.

http://www.addgene.org/196709

Vector Backbone Description: Backbone Marker:Feng Zhang Lab; Vector Backbone:lentiGuide-Puro (#52963); Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28993443

Proper citation: RRID:Addgene_196709 Copy   


  • RRID:Addgene_193792

http://www.addgene.org/193792

Species: Bacteriophage lambda
Genetic Insert: Two copies of frame-shifted CI in opposite orientation, controlled by separate promoters and terminators
Vector Backbone Description: Backbone Size:2200; Vector Backbone:pZ; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30867677

Proper citation: RRID:Addgene_193792 Copy   


  • RRID:Addgene_198322

    This resource has 1+ mentions.

http://www.addgene.org/198322

Vector Backbone Description: Backbone Marker:Coleman; Backbone Size:4690; Vector Backbone:pUS250; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: CLONING: The multiple cloning site (MCS) in pUS250 functions differently to a typical MCS. You need to choose one unique restriction site on the left side of the amilCP marker gene (e.g. EcoRI), and one unique restriction site on the right side (e.g. PstI) in order for the blue/white selection and the cumate-inducible expression features to work properly. Cutting the plasmid in this way excises the amilCP gene, replacing it with your gene of interest, and changing the phenotype from blue to white. The vector is also compatible with GoldenGate cloning (using either BsaI or Esp3I) and BioBrick cloning (iGEM). In the case of GoldenGate cloning, you don't need to use two different enzymes, you just use one or the other, since each enzyme has two sites, one on each side of amilCP, and each yields a different overhang. HOST RANGE and EXPRESSION: we have shown that pUS250 can be used for cumate-inducible gene expression in E.coli, Pseudomonas putida, and Rhizobium leguminosarum. It is likely that the plasmid will also be useful in other gram negatives (Proteobacteria) since the pBBR replicon has a very broad host range. The plasmid can be transferred by conjugation from E.coli strains such as S17 or SM10 into other species due to the oriT sequence. For the E.coli and Rhizobium, 100 uM cumate is sufficient for expression. For Pseudomonas, this needs to be increased to 10 mM (we think there is an efflux pump that pumps cumate back out of these cells). The cumate should be added after autoclaving. We make a 0.5 M cumate stock solution by mixing equal parts of 1M aqueous Tris base with 1M cumic acid in ethanol. Cumate is an excellent inducer since it is both cheap and non-toxic to both bacteria and people. You can even use cumin (the spice) for induction of gene expression in this plasmid! (there is enough cumate in the cumin). STABILITY and COPY NUMBER: We estimate that the vector has a copy number of 5-10 in E.coli, so it is certainly a low copy vector. Best to make large-scale plasmid preps (e.g. 50 ml culture) rather than small-scale, in order to ensure you get enough plasmid DNA to work with. The plasmid is quite stable but we have seen white mutants appear occasionally which have deletions in amilCP.

Proper citation: RRID:Addgene_198322 Copy   


  • RRID:Addgene_198443

http://www.addgene.org/198443

Species: Zika Virus (KJ776791.2)
Genetic Insert: glycine linked Zika virus NS2B-NS3
Vector Backbone Description: Backbone Marker:MilliporeSigma (Novagen); Backbone Size:5677; Vector Backbone:pET11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37379675

Proper citation: RRID:Addgene_198443 Copy   


http://www.addgene.org/196715

Vector Backbone Description: Backbone Marker:Feng Zhang Lab; Vector Backbone:lenti dCas9-VP64_Blast (#61425); Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_196715 Copy   


http://www.addgene.org/196716

Species: S. pyogenes
Genetic Insert: dCas9-TagBFP-KRAB(ZIM3)
Vector Backbone Description: Backbone Marker:Feng Zhang Lab; Vector Backbone:lenti dCas9-VP64_Blast (#61425); Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_196716 Copy   


  • RRID:Addgene_196713

    This resource has 1+ mentions.

http://www.addgene.org/196713

Species: S. pyogenes
Genetic Insert: Cas9-T2A-BSD-U6-sgHPRT1
Vector Backbone Description: Backbone Marker:Feng Zhang Lab; Vector Backbone:lenti dCas9-VP64_Blast (#61425); Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28993443

Proper citation: RRID:Addgene_196713 Copy   


  • RRID:Addgene_196712

    This resource has 1+ mentions.

http://www.addgene.org/196712

Species: S. pyogenes
Genetic Insert: dCas9-KRAB(ZIM3)-T2A-TagBFP
Vector Backbone Description: Backbone Marker:Feng Zhang Lab; Vector Backbone:lenti dCas9-VP64_Blast (#61425); Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_196712 Copy   


  • RRID:Addgene_199267

http://www.addgene.org/199267

Species: Mus musculus
Genetic Insert: PE2-P2A-mp53DD
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36302757

Proper citation: RRID:Addgene_199267 Copy   


  • RRID:Addgene_198330

    This resource has 1+ mentions.

http://www.addgene.org/198330

Genetic Insert: U6-sgRNA(F+E) empty
Vector Backbone Description: Backbone Marker:Addgene 54563; Backbone Size:4722; Vector Backbone:mCherry2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37063065
Comments: Users should follow the oligo cloning protocol from the Zhang lab for plasmid lentiCRISPR v2 (Addgene #52961) to 1) remove stuffer fragment and 2) insert annealed oligos to complete gRNA.

Proper citation: RRID:Addgene_198330 Copy   


  • RRID:Addgene_183695

http://www.addgene.org/183695

Vector Backbone Description: Vector Backbone:pEF1; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35523806
Comments: This plasmid also expresses MS2-p65-HSF1 activation domains as CRISPRa synergistic Activation Mediators (SAM) and mCherry

Proper citation: RRID:Addgene_183695 Copy   


http://www.addgene.org/183694

Species: gRNA
Genetic Insert: gRNA targeting chinese hamster Bip (Hspa5)
Vector Backbone Description: Vector Backbone:pPGK; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35523806
Comments: This plasmid also expresses TagBFP

Proper citation: RRID:Addgene_183694 Copy   


http://www.addgene.org/183692

Species: Bacterial
Genetic Insert: ER Halo(K73T)
Vector Backbone Description: Vector Backbone:pET30; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35523806

Proper citation: RRID:Addgene_183692 Copy   


http://www.addgene.org/198140

Species: Mus musculus
Genetic Insert: mini-Agrin
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_198140 Copy   


http://www.addgene.org/198380

Species: Homo sapiens
Genetic Insert: N-Terminal 3X Flag Human Caspase-9 C287A Mutant
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4994; Vector Backbone:pCR3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32397873

Proper citation: RRID:Addgene_198380 Copy   


http://www.addgene.org/195204

Species: Mus musculus
Genetic Insert: mFirre 1.49 Clone
Vector Backbone Description: Backbone Size:4761; Vector Backbone:pDONR221; Vector Types:Gateway Cloning Intermediate; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24463464

Proper citation: RRID:Addgene_195204 Copy   


  • RRID:Addgene_192859

http://www.addgene.org/192859

Species: Escherichia coli
Genetic Insert: lldR operon
Vector Backbone Description: Backbone Size:4866; Vector Backbone:pMUT2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36449712

Proper citation: RRID:Addgene_192859 Copy   


  • RRID:Addgene_192858

http://www.addgene.org/192858

Species: Escherichia coli
Genetic Insert: Acetoacetate inducible promoter
Vector Backbone Description: Backbone Size:5591; Vector Backbone:pMUT2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36449712

Proper citation: RRID:Addgene_192858 Copy   


  • RRID:Addgene_198399

    This resource has 1+ mentions.

http://www.addgene.org/198399

Species: Homo sapiens
Genetic Insert: MUC4 sgRNA
Vector Backbone Description: Backbone Marker:Addgene 198330; Backbone Size:5258; Vector Backbone:pmCherry-sgRNA (empty); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37063065
Comments: MUC4 guide sequence used is from Chen et al., 2013 (/doi.org/10.1016/j.cell.2013.12.001), where it is referred to as MUC4-E3. Target sequence: GGCGTGACCTGTGGATGCTG

Proper citation: RRID:Addgene_198399 Copy   


  • RRID:Addgene_198432

http://www.addgene.org/198432

Species: Zika Virus (KJ776791.2)
Genetic Insert: glycine linked Zika virus NS2B-NS3
Vector Backbone Description: Backbone Marker:MilliporeSigma (Novagen); Backbone Size:5677; Vector Backbone:pET11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37379675

Proper citation: RRID:Addgene_198432 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Kravitz Dataset1 Resources

    Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within Kravitz that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X