Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 35 showing 681 ~ 700 out of 742,581 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_104536

    This resource has 1+ mentions.

http://www.addgene.org/104536

Vector Backbone Description: Backbone Marker:Systems Biosciences; Backbone Size:4700; Vector Backbone:Piggybac; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR, Synthetic Biology, Piggybac transposon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30093604

Proper citation: RRID:Addgene_104536 Copy   


  • RRID:Addgene_104508

http://www.addgene.org/104508

Species: Saccharomyces eubayanus
Genetic Insert: SeGAL2 promoter-yEGFP
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29301066

Proper citation: RRID:Addgene_104508 Copy   


  • RRID:Addgene_104590

    This resource has 1+ mentions.

http://www.addgene.org/104590

Species: HIV-1 virus
Genetic Insert: 2LTR circle junction of HIV-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3001; Vector Backbone:pGemT; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18762215
Comments: During HIV-1 infection, unintegrated viral cDNA may be circularized. The circularization generates a unique junction between the long terminal repeat (LTR) ends. HIV-1 2LTR circles have been quantified as measure of viral replication or entry of the viral cDNA into the host cell nucleus. The amplicon is 2672-2879 in the Addgene sequence file. This corresponds to HIV-1 strain HXB2 reference genome 9585-9719 bp (Addgene 2672-2806 bp) fused to 1 to 51 bp (Addgene 2829-2879 bp). In this plasmid there are 22 bp (Addgene 2807-2828 bp) of random sequence inserted between the HIV-1 ends. The insert may be amplified with primers MH535 (5' AACTAGGGAACCCACTGCTTAAG), MH536 (5' TCCACAGATCAAGGATATCTTGTC), and Taqman probe MH603 (5' ACACTACTTGAAGCACTCAAGGCAAGCTTT).

Proper citation: RRID:Addgene_104590 Copy   


  • RRID:Addgene_104581

http://www.addgene.org/104581

Species: Mus musculus
Genetic Insert: Mouse IgG2c CH1/CH2/CH3 (mutated, no effector functions)
Vector Backbone Description: Backbone Marker:Invitrogen (Thermo Fisher); Backbone Size:10143; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30196504

Proper citation: RRID:Addgene_104581 Copy   


  • RRID:Addgene_104583

    This resource has 1+ mentions.

http://www.addgene.org/104583

Species: Homo sapiens
Genetic Insert: Human IgG1 CH1/CH2/CH3
Vector Backbone Description: Backbone Marker:Invitrogen (Thermo Fisher); Backbone Size:10143; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30196504
Comments: Addgene NGS results found A169G, A261G, A292G, and A295G within the EBNA1 translation on the pCEP4 backbone compared to YP_401677.1

Proper citation: RRID:Addgene_104583 Copy   


  • RRID:Addgene_104504

http://www.addgene.org/104504

Species: Saccharomyces kudriavzevii
Genetic Insert: SkGAL1 promoter-yEGFP
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29301066

Proper citation: RRID:Addgene_104504 Copy   


  • RRID:Addgene_104507

http://www.addgene.org/104507

Species: Saccharomyces mikatae
Genetic Insert: SmGAL2 promoter-yEGFP
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29301066

Proper citation: RRID:Addgene_104507 Copy   


  • RRID:Addgene_104506

http://www.addgene.org/104506

Species: Saccharomyces paradoxus
Genetic Insert: SpGAL1 promoter-yEGFP
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29301066

Proper citation: RRID:Addgene_104506 Copy   


  • RRID:Addgene_104501

http://www.addgene.org/104501

Species: Aequoria Victoria, Opsanus
Genetic Insert: Twitch-2C
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24390440

Proper citation: RRID:Addgene_104501 Copy   


  • RRID:Addgene_104589

    This resource has 1+ mentions.

http://www.addgene.org/104589

Species: Mus musculus
Genetic Insert: calcium/calmodulin-dependent protein kinase II alpha
Vector Backbone Description: Backbone Size:2905; Vector Backbone:PX551; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29056297

Proper citation: RRID:Addgene_104589 Copy   


  • RRID:Addgene_104588

    This resource has 1+ mentions.

http://www.addgene.org/104588

Species: Synthetic
Genetic Insert: Streptococcus pyogenes Cas9
Vector Backbone Description: Backbone Marker:Addgene #60957; Backbone Size:2905; Vector Backbone:PX551; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29056297

Proper citation: RRID:Addgene_104588 Copy   


  • RRID:Addgene_104516

http://www.addgene.org/104516

Species: Other
Genetic Insert: Gala7 promoter
Vector Backbone Description: Backbone Marker:Parniske lab; Backbone Size:2458; Vector Backbone:pUC57; Vector Types:Cloning vector; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29077245

Proper citation: RRID:Addgene_104516 Copy   


  • RRID:Addgene_104518

http://www.addgene.org/104518

Species: Other
Genetic Insert: Gateway cassette
Vector Backbone Description: Backbone Marker:Parniske lab; Backbone Size:2458; Vector Backbone:pUC57; Vector Types:Cloning vector; Bacterial Resistance:Chloramphenicol and Gentamicin
Defining Citation: PMID:29077245

Proper citation: RRID:Addgene_104518 Copy   


  • RRID:Addgene_104514

http://www.addgene.org/104514

Species: Other
Genetic Insert: hrpB promoter
Vector Backbone Description: Backbone Marker:Parniske lab; Backbone Size:2458; Vector Backbone:pUC57; Vector Types:Cloning vector; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29077245

Proper citation: RRID:Addgene_104514 Copy   


  • RRID:Addgene_104513

http://www.addgene.org/104513

Species: Saccharomyces uvarum
Genetic Insert: SuGAL2 promoter-yEGFP
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29301066

Proper citation: RRID:Addgene_104513 Copy   


  • RRID:Addgene_111438

http://www.addgene.org/111438

Species: Synthetic
Genetic Insert: CaCas9/sgCgADE2
Vector Backbone Description: Backbone Marker:RS Sikorski; Vector Backbone:pRS416; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29695624

Proper citation: RRID:Addgene_111438 Copy   


  • RRID:Addgene_111543

    This resource has 1+ mentions.

http://www.addgene.org/111543

Species: Synthetic
Genetic Insert: GCaMP6m-XC
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29666364

Proper citation: RRID:Addgene_111543 Copy   


  • RRID:Addgene_111541

http://www.addgene.org/111541

Species: Homo sapiens
Genetic Insert: thy1.2-Kv2.1-HA
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pCI-neo; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27798188

Proper citation: RRID:Addgene_111541 Copy   


http://www.addgene.org/111547

Species: Drosophila melanogaster
Genetic Insert: ChrimsonR_mCherry_trafficked
Vector Backbone Description: Vector Backbone:10XUAS IVS sv40; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24509633

Proper citation: RRID:Addgene_111547 Copy   


http://www.addgene.org/111545

Species: Drosophila melanogaster
Genetic Insert: CsChrimson_tdtomato_trafficked
Vector Backbone Description: Vector Backbone:5XUAS IVS sv40; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24509633

Proper citation: RRID:Addgene_111545 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Kravitz Dataset1 Resources

    Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within Kravitz that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X