Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Long single strand DNA production; Bacterial Resistance:Ampicillin
Comments: Note that this is only a pUC19 removed indicated intrisic enzyme site, BspQI or BsrDI needed for ssDNA preparation need to be introduced together with the inserts. Mutations were introduced as discribed in "https://www.neb.com/-/media/nebus/files/application-notes/appnote_improved_methods_for_sdm_using_nebuilder_hifi_dna_assembly_master_mix.pdf"
>mutagenesis_primers
pUC-ΔBts592-F: 5' CGTTGCGCTCACAGCCCGCTTTCCAG 3'
pUC-ΔBts592-R: 5' CTGGAAAGCGGGCTGTGAGCGCAACG 3'
pUC-ΔBspQ690-F: 5' GTATTGGGCGCTGTTCCGCTTCCTC 3'
pUC-ΔBspQ690-R: 5' GAGGAAGCGGAACAGCGCCCAATAC 3'
pUC-ΔBsrD1760-F: 5' CAGTGCTGCAATAATACCGCGAGACC 3'
pUC-ΔBsrD1760-R: 5' GGTCTCGCGGTATTATTGCAGCACTG 3'
pUC-ΔBsrD1934-F: 5' CGTTGTTGCCATAGCTACAGGCATCGTG 3'
pUC-ΔBsrD1934-R: 5' CACGATGCCTGTAGCTATGGCAACAACG 3'
pUC-ΔBts2099&2119-F: 5' CCGCTGTGTTATCACTCATGGTTATGGCAGCACTACATAATTCTC 3'
pUC-ΔBts2099&2119-R: 5' TATGTAGTGCTGCCATAACCATGAGTGATAACACAGCGGCCAAC 3'
Proper citation: RRID:Addgene_208642 Copy
Species: Synthetic
Genetic Insert: sgATG7
Vector Backbone Description: Vector Backbone:pLentiCRISPR-v2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39592843
Proper citation: RRID:Addgene_211534 Copy
Species: Schmallenberg orthobunyavirus
Genetic Insert: NSs
Vector Backbone Description: Backbone Marker:Tony Pawson; Backbone Size:4195; Vector Backbone:V27 pLPS-3' HA - Acceptor; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_208938 Copy
Species: Other
Genetic Insert: NSs
Vector Backbone Description: Backbone Marker:Christopher A Walsh; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_208934 Copy
Species: Oropouche orthobunyavirus
Genetic Insert: NSm
Vector Backbone Description: Backbone Marker:Christopher A Walsh; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_208935 Copy
Species: Oropouche orthobunyavirus
Genetic Insert: Gc
Vector Backbone Description: Backbone Marker:Christopher A Walsh; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_208936 Copy
Species: Oropouche orthobunyavirus
Genetic Insert: Nucleocapsid
Vector Backbone Description: Backbone Marker:Christopher A Walsh; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_208937 Copy
Species: Other
Genetic Insert: Gc
Vector Backbone Description: Backbone Marker:Christopher A Walsh; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_208933 Copy
Species: Mus musculus
Genetic Insert: sgControl (TP53BP1 intron)
Vector Backbone Description: Vector Backbone:LentiCRISPR V2-Cre-NLuc; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38200309
Proper citation: RRID:Addgene_208383 Copy
Species: Mus musculus
Genetic Insert: sgMRE11
Vector Backbone Description: Vector Backbone:LentiCRISPR V2-Cre-NLuc; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38200309
Proper citation: RRID:Addgene_208384 Copy
Species: Medicago truncatula
Genetic Insert: MtU6-26 SnRNA promoter
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Cloning Vector; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_209191 Copy
Species: Synthetic
Genetic Insert: TopFlash-NanoLucP
Vector Backbone Description: Backbone Marker:n/a; Vector Backbone:piggybac; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37949072
Proper citation: RRID:Addgene_204347 Copy
Species: Homo sapiens
Genetic Insert: NUbo-E3(48)-mCherry-P2A-3xFLAG-Ubc7
Vector Backbone Description: Vector Backbone:pcDNA5-FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38103558
Comments: pHU5705; codon-optimized for mammalian cells
Proper citation: RRID:Addgene_212805 Copy
Species: Homo sapiens
Genetic Insert: lamin A (565-646)
Vector Backbone Description: Backbone Size:4939; Vector Backbone:pGEX4t1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37219077
Proper citation: RRID:Addgene_204583 Copy
Species: Mus musculus
Genetic Insert: sgZBP1
Vector Backbone Description: Vector Backbone:LentiCRISPR V2-Cre-NLuc; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38200309
Proper citation: RRID:Addgene_208387 Copy
Species: Homo sapiens
Genetic Insert: human lamin A (389-597)
Vector Backbone Description: Backbone Size:4939; Vector Backbone:pGEX4t1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37219077
Proper citation: RRID:Addgene_204588 Copy
Species: Mus musculus
Genetic Insert: sgZBP1
Vector Backbone Description: Vector Backbone:LentiCRISPR V2-Cre-NLuc; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38200309
Proper citation: RRID:Addgene_208389 Copy
Species: Homo sapiens
Genetic Insert: lamin A (389-626)
Vector Backbone Description: Backbone Size:4939; Vector Backbone:pGEX4t1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37219077
Proper citation: RRID:Addgene_204586 Copy
Species: Homo sapiens
Genetic Insert: Human MRE11
Vector Backbone Description: Vector Backbone:pBABE-Puro-Halo; Vector Types:Mammalian Expression, Retroviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38200309
Proper citation: RRID:Addgene_208394 Copy
Species: Homo sapiens
Genetic Insert: Human cGAS
Vector Backbone Description: Vector Backbone:PB-TA-ERP2; Vector Types:Mammalian Expression, PiggyBac Transposon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38200309
Proper citation: RRID:Addgene_208396 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within Kravitz that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
