Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Triticum aestivum
Genetic Insert: D16: Promoter of TraesCS5D02G320700
Vector Backbone Description: Vector Backbone:pAGM9121; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Proper citation: RRID:Addgene_201306 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Ubc7
Vector Backbone Description: Vector Backbone:pMAL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38103558
Comments: pHU3365
Proper citation: RRID:Addgene_212713 Copy
Species: Homo sapiens
Genetic Insert: UBCH7
Vector Backbone Description: Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38103558
Comments: pHU3602
Proper citation: RRID:Addgene_212711 Copy
Species: Synthetic
Genetic Insert: fLUC
Vector Backbone Description: Vector Backbone:pICH47802; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_201315 Copy
Vector Backbone Description: Vector Backbone:pET24a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38103558
Comments: pHU5797
Proper citation: RRID:Addgene_212727 Copy
Species: Homo sapiens
Genetic Insert: human RPL3 (ENST00000216146) aa 212~285
Vector Backbone Description: Vector Backbone:pET28-mEGFP(A206K)-TwStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_208629 Copy
Vector Backbone Description: Vector Backbone:pET24a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38103558
Comments: pHU5796
Proper citation: RRID:Addgene_212726 Copy
Species: Homo sapiens
Genetic Insert: human RPL3 (ENST00000216146) aa 1~77
Vector Backbone Description: Vector Backbone:pET28-mEGFP(A206K)-TwStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_208624 Copy
Species: Homo sapiens
Genetic Insert: SMARCA4(43), SMARCA2(47)
Vector Backbone Description: Backbone Marker:addgene; Backbone Size:9030; Vector Backbone:pKLV2.2-h7SKgRNA5(SapI)-hU6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37922452
Proper citation: RRID:Addgene_200505 Copy
Vector Backbone Description: Vector Backbone:pET24a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38103558
Comments: pHU5793
Proper citation: RRID:Addgene_212723 Copy
Species: Homo sapiens
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38103558
Comments: pHU5335; cloning method: site-directed mutagenesis
Proper citation: RRID:Addgene_212721 Copy
Species: Hepatitis C virus
Genetic Insert: Hepatitis C virus (HCV) strain JFH1(AB047639) nt 1~398
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Luciferase, In vitro transcription template; Bacterial Resistance:Ampicillin
Comments: For in vitro transcription, Linearize with XbaI
Proper citation: RRID:Addgene_208639 Copy
Species: Homo sapiens
Genetic Insert: human RBM24 (ENST00000216146) aa 95~236
Vector Backbone Description: Backbone Marker:Merck-Millipore (Novagen); Vector Backbone:pET28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: #important# For this plasmid, we failed to obtain enough soluble protein with standard protocol using BL21(DE3) and Ni-NTA. Need further optimization.
Proper citation: RRID:Addgene_208634 Copy
Species: Homo sapiens
Genetic Insert: human RPL3 (ENST00000216146) Δ1~34, Δ215~284
Vector Backbone Description: Vector Backbone:pET28-3'TwStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: reverse primer is on Twin Strep tag.
additional primers for internal deletion:
hRPL3-Δ215~284-F: 5' GTGAACCAAGTGTTTGGGCAGGATTATAAGATTGGCCAGGGCTAC 3'
hRPL3-Δ215~284-R: 5' GTAGCCCTGGCCAATCTTATAATCCTGCCCAAACACTTGGTTCAC 3'
Proper citation: RRID:Addgene_208630 Copy
Species: Streptococcus thermophilus
Genetic Insert: Bifunctional glutamate-cysteine ligase/glutathione synthetase GshF
Vector Backbone Description: Backbone Marker:Cell Biolabs; Backbone Size:5600; Vector Backbone:pMXS-IRES-Blast; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34707288
Comments: Humanized from the Streptococcus thermophilus GshF sequence initially cloned by Li et. al (PMID: 21683099)
Proper citation: RRID:Addgene_210313 Copy
Species: Streptococcus thermophilus
Genetic Insert: Bifunctional glutamate-cysteine ligase/glutathione synthetase GshF
Vector Backbone Description: Backbone Marker:Cell Biolabs; Backbone Size:5600; Vector Backbone:pMXS-IRES-Blast; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34707288
Proper citation: RRID:Addgene_210314 Copy
Species: Homo sapiens
Genetic Insert: CDK6-E2(12)
Vector Backbone Description: Backbone Marker:addgene; Backbone Size:8648; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37922452
Proper citation: RRID:Addgene_200488 Copy
Species: Homo sapiens
Genetic Insert: Twin Strep tag with RPL3 genome HomoArm
Vector Backbone Description: Vector Backbone:pUC-ODN; Vector Types:CRISPR, ssDNA donnor preparation for knock-in of RPL3 C-ter tag; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_208645 Copy
Vector Backbone Description: Backbone Marker:Thermo Fisher (Invitrogen); Vector Backbone:pcDNA3.1 (-); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: Lenti virus related sequences was not included, for use at Biosafety Level 1. Clone sgRNA as discribed in the document of lentiCRISPRv2 with BsmBI. Note that CMV enhancer-promoter in pcDNA3.1 is not removed, thus the sgRNA would be promoted by tandem CMV-U6 promoter.
Proper citation: RRID:Addgene_208646 Copy
Species: Homo sapiens
Genetic Insert: sgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.62
Vector Backbone Description: Vector Backbone:pcDNA3.1-CRISPR-Puro; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: co-transfect with pcDNA3.1-CRISPR-Puro-sgRPL3-56 (Addgene#208979) for better knock-in, single cut not perfermed good for knock-in.
Proper citation: RRID:Addgene_208647 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within Kravitz that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
