Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mycobacterium phage
Genetic Insert: oBxb1
Vector Backbone Description: Vector Backbone:minimal cloning vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_181777 Copy
Species: humanized S. pyogenes Cas9
Genetic Insert: Slc17a7 guide
Vector Backbone Description: Backbone Marker:Feng Zhang; Vector Backbone:pX330 ; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_181775 Copy
Species: humanized S. pyogenes Cas9
Genetic Insert: Sncg guide
Vector Backbone Description: Backbone Marker:Feng Zhang; Vector Backbone:pX330 ; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_181774 Copy
Species: Homo sapiens
Genetic Insert: hTRF1
Vector Backbone Description: Backbone Size:1314; Vector Backbone:pHAGE2; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32497497
Comments: Please note: This plasmid contains an E296D mutation hTRF1. This mutation is not known to affect plasmid function.
Proper citation: RRID:Addgene_182588 Copy
Species: Homo sapiens
Genetic Insert: promoter 1-3
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4283; Vector Backbone:pGL4.23[luc2/minP]; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37379322
Comments: A 19 bp insertion between insert and backbone sequence was found.
Proper citation: RRID:Addgene_210629 Copy
Species: Synthetic
Genetic Insert: CaMKAR
Vector Backbone Description: Backbone Size:5408; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37343080
Proper citation: RRID:Addgene_205315 Copy
Species: Bradyrhizobium tropiciagri SEMIA 6148
Genetic Insert: Bradyrhizobium bGSDM
Vector Backbone Description: Backbone Marker:custom; Backbone Size:5932; Vector Backbone:pETSUMO2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35025633
Proper citation: RRID:Addgene_212126 Copy
Species: Synthetic
Genetic Insert: nls-tagged EGFP and nls-tagged dTomato
Vector Backbone Description: Vector Backbone:TIGRE3.0 targeting vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_181760 Copy
Vector Backbone Description: Backbone Marker:Merck-Millipore (Novagen); Vector Backbone:pET28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: We optimized nucleic acid sequence of Twin Strep, eliminated tandem repeats, for better oligo assembly. The nucleic acids are different from that of IBA lifescience, amino acids are the same. The Twin Strep tag was synthesized by oligo assembly using following oligos:
# Sequence 5'-3' bp
pET28-TwStrp.o1: CGACAAGCTTTCCGGAGGGAGCGCTTGGAGCCACCCGCAGTTCGAA 46
pET28-TwStrp.o2: CGATCCACCGCCAGAACCTCCACCTTTTTCGAACTGCGGGTGGCTC 46
TwStrp.opt.o3: AGGTTCTGGCGGTGGATCGGGAGGTTCAGCGTGGTCTCACCCCCAA 46
TwStrp.opt.o4: GGTGCTCGAGCTATTACTTCTCAAATTGGGGGTGAGACCACGCT 44
Proper citation: RRID:Addgene_208053 Copy
Species: Synthetic
Genetic Insert: GCaMP7s and tTA2
Vector Backbone Description: Vector Backbone:TIGRE3.0 targeting vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_181762 Copy
Species: Synthetic
Genetic Insert: nls-tagged EGFP and tdTomato
Vector Backbone Description: Vector Backbone:TIGRE3.0 targeting vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_181761 Copy
Vector Backbone Description: Backbone Marker:Thermo Fisher (Invitrogen); Backbone Size:5427; Vector Backbone:pcDNA3.1 (-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_208051 Copy
Species: Homo sapiens
Genetic Insert: human RBM24 (ENST00000379052) coding region
Vector Backbone Description: Backbone Marker:Thermo Fisher (invitrogen); Vector Backbone:pcDNA3.1-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_208052 Copy
Species: Synthetic
Genetic Insert: GCaMP7f and tTA2
Vector Backbone Description: Vector Backbone:TIGRE3.0 targeting vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_181763 Copy
Species: humanized S. pyogenes Cas9
Genetic Insert: Ctxn3 guide
Vector Backbone Description: Backbone Marker:Feng Zhang; Vector Backbone:pX330 ; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_181769 Copy
Species: Homo sapiens
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:pET24a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38103558
Comments: pHU5332
Proper citation: RRID:Addgene_212718 Copy
Species: Homo sapiens
Genetic Insert: E3(63)
Vector Backbone Description: Vector Backbone:pET24a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38103558
Comments: pHU3226
Proper citation: RRID:Addgene_212717 Copy
Vector Backbone Description: Backbone Marker:Thermo Fisher (Invitrogen); Vector Backbone:pcDNA3.1 (-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_208616 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Mms2
Vector Backbone Description: Vector Backbone:pET30; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38103558
Comments: pHU2807
Proper citation: RRID:Addgene_212716 Copy
Species: Triticum aestivum
Genetic Insert: Sr27
Vector Backbone Description: Vector Backbone:pAGM9121; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Proper citation: RRID:Addgene_201307 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within Kravitz that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
