Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Danio rerio
Genetic Insert: Targeted 2aGal4VP16 protein trap; secondary marker cmlc2 GFP
Vector Backbone Description: Backbone Marker:K.Clark; Backbone Size:7200; Vector Backbone:pKTol2-SE; Vector Types:Targetable insertional mutagen and reporter system; Bacterial Resistance:Kanamycin
Comments: This plasmid is designed to have homology domains cloned into the 5' end and 3' end. Bfuai is used to clone in the 5' homology domain, while BspQi is used to clone in the 3' homology domain.
Proper citation: RRID:Addgene_188022 Copy
Species: Synthetic
Genetic Insert: Adenovirus major late promoter (MLP) with barcode 1405
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38635397
Proper citation: RRID:Addgene_214670 Copy
Species: Synthetic
Genetic Insert: Snap
Vector Backbone Description: Backbone Marker:Antibody Design Labs; Backbone Size:3960; Vector Backbone:pADL-23c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38841291
Proper citation: RRID:Addgene_210407 Copy
Vector Backbone Description: Backbone Marker:Antibody Design Labs; Backbone Size:3960; Vector Backbone:pADL-23c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38841291
Proper citation: RRID:Addgene_210406 Copy
Vector Backbone Description: Backbone Marker:Antibody Design labs; Backbone Size:3960; Vector Backbone:pADL-23c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38841291
Proper citation: RRID:Addgene_210402 Copy
Species: Danio rerio
Genetic Insert: Targeted mRFP protein trap; secondary marker cmlc2 BFP
Vector Backbone Description: Backbone Marker:K.Clark; Backbone Size:7200; Vector Backbone:pKTol2-SE; Vector Types:Targetable insertional mutagen and reporter system; Bacterial Resistance:Kanamycin
Comments: This plasmid is designed to have homology domains cloned into the 5' end and 3' end. Bfuai is used to clone in the 5' homology domain, while BspQi is used to clone in the 3' homology domain.
Proper citation: RRID:Addgene_188001 Copy
Species: Danio rerio
Genetic Insert: Targeted mRFP protein trap; secondary marker cmlc2 BFP
Vector Backbone Description: Backbone Marker:K.Clark; Backbone Size:7200; Vector Backbone:pKTol2-SE; Vector Types:Targetable insertional mutagen and reporter system; Bacterial Resistance:Kanamycin
Comments: This plasmid is designed to have homology domains cloned into the 5' end and 3' end. Bfuai is used to clone in the 5' homology domain, while BspQi is used to clone in the 3' homology domain.
Proper citation: RRID:Addgene_188002 Copy
Species: Danio rerio
Genetic Insert: Targeted mRFP protein trap; secondary marker cmlc2 GFP
Vector Backbone Description: Backbone Marker:K.Clark; Backbone Size:7200; Vector Backbone:pKTol2-SE; Vector Types:Targetable insertional mutagen and reporter system; Bacterial Resistance:Kanamycin
Comments: This plasmid is designed to have homology domains cloned into the 5' end and 3' end. Bfuai is used to clone in the 5' homology domain, while BspQi is used to clone in the 3' homology domain.
Proper citation: RRID:Addgene_188004 Copy
Species: Danio rerio
Genetic Insert: Targeted mRFP protein trap; secondary marker cmlc2 GFP
Vector Backbone Description: Backbone Marker:K.Clark; Backbone Size:7200; Vector Backbone:pKTol2-SE; Vector Types:Targetable insertional mutagen and reporter system; Bacterial Resistance:Kanamycin
Comments: This plasmid is designed to have homology domains cloned into the 5' end and 3' end. Bfuai is used to clone in the 5' homology domain, while BspQi is used to clone in the 3' homology domain.
Proper citation: RRID:Addgene_188006 Copy
Species: Danio rerio
Genetic Insert: Targeted mRFP protein trap; secondary marker insulin BFP
Vector Backbone Description: Backbone Marker:K.Clark; Backbone Size:7200; Vector Backbone:pKTol2-SE; Vector Types:Targetable insertional mutagen and reporter system; Bacterial Resistance:Kanamycin
Comments: This plasmid is designed to have homology domains cloned into the 5' end and 3' end. Bfuai is used to clone in the 5' homology domain, while BspQi is used to clone in the 3' homology domain.
Proper citation: RRID:Addgene_188009 Copy
Species: Homo sapiens
Genetic Insert: E3(1)
Vector Backbone Description: Vector Backbone:pFastBac1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38103558
Comments: pHU5569
Proper citation: RRID:Addgene_212712 Copy
Species: Danio rerio
Genetic Insert: Targeted 2aGal4VP16 protein trap; secondary marker gamma crystallin BFP
Vector Backbone Description: Backbone Marker:K.Clark; Backbone Size:7200; Vector Backbone:pKTol2-SE; Vector Types:Targetable insertional mutagen and reporter system; Bacterial Resistance:Kanamycin
Comments: This plasmid is designed to have homology domains cloned into the 5' end and 3' end. Bfuai is used to clone in the 5' homology domain, while BspQi is used to clone in the 3' homology domain.
Proper citation: RRID:Addgene_188013 Copy
Species: Danio rerio
Genetic Insert: Targeted 2aGal4VP16 protein trap; secondary marker gamma crystallin GFP
Vector Backbone Description: Backbone Marker:K.Clark; Backbone Size:7200; Vector Backbone:pKTol2-SE; Vector Types:Targetable insertional mutagen and reporter system; Bacterial Resistance:Kanamycin
Comments: This plasmid is designed to have homology domains cloned into the 5' end and 3' end. Bfuai is used to clone in the 5' homology domain, while BspQi is used to clone in the 3' homology domain.
Proper citation: RRID:Addgene_188016 Copy
Species: Danio rerio
Genetic Insert: Targeted 2aGal4VP16 protein trap; secondary marker gamma crystallin GFP
Vector Backbone Description: Backbone Marker:K.Clark; Backbone Size:7200; Vector Backbone:pKTol2-SE; Vector Types:Targetable insertional mutagen and reporter system; Bacterial Resistance:Kanamycin
Comments: This plasmid is designed to have homology domains cloned into the 5' end and 3' end. Bfuai is used to clone in the 5' homology domain, while BspQi is used to clone in the 3' homology domain.
Proper citation: RRID:Addgene_188018 Copy
Species: Mus musculus
Genetic Insert: mAIRN
Vector Backbone Description: Backbone Marker:Thermo Fisher; Backbone Size:10400; Vector Backbone:pCEP4 Mammalian Expression Vector; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28802045
Proper citation: RRID:Addgene_207412 Copy
Species: Mus musculus
Genetic Insert: anti-GFP (Aequorea victoria) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2941291. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute
Proper citation: RRID:Addgene_206720 Copy
Species: Danio rerio
Genetic Insert: Targeted mRFP protein trap; secondary marker insulin GFP
Vector Backbone Description: Backbone Marker:K.Clark; Backbone Size:7200; Vector Backbone:pKTol2-SE; Vector Types:Targetable insertional mutagen and reporter system; Bacterial Resistance:Kanamycin
Comments: This plasmid is designed to have homology domains cloned into the 5' end and 3' end. Bfuai is used to clone in the 5' homology domain, while BspQi is used to clone in the 3' homology domain.
Proper citation: RRID:Addgene_188011 Copy
Species: Synthetic
Genetic Insert: 10x clustered UAS element with barcode 0385
Vector Backbone Description: Vector Backbone:pGL4; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38635397
Proper citation: RRID:Addgene_214622 Copy
Species: Caenorhabditis elegans
Genetic Insert: eef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
Vector Backbone Description: Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38351905
Proper citation: RRID:Addgene_215676 Copy
Species: Caenorhabditis elegans
Genetic Insert: eef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
Vector Backbone Description: Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38351905
Proper citation: RRID:Addgene_215675 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within Kravitz that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.