Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 159 showing 3161 ~ 3180 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/217333

Species: Acidaminococcus
Genetic Insert: denAsCas12a
Vector Backbone Description: Backbone Marker:Mario Capecchi; Vector Backbone:Addgene plasmid # 133568; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38760567
Comments: Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint.

Proper citation: RRID:Addgene_217333 Copy   


http://www.addgene.org/215034

Species: Homo sapiens
Genetic Insert: twist family bHLH transcription factor 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5366; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38262408

Proper citation: RRID:Addgene_215034 Copy   


  • RRID:Addgene_208191

    This resource has 1+ mentions.

http://www.addgene.org/208191

Species: Synthetic
Genetic Insert: GFPmut2
Vector Backbone Description: Backbone Size:3968; Vector Backbone:pSC101; Vector Types:Bacterial Expression, reporter; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38519558

Proper citation: RRID:Addgene_208191 Copy   


http://www.addgene.org/211115

Species: Homo sapiens
Genetic Insert: 5' C-term Top2A homology arm
Vector Backbone Description: Backbone Marker:ThermoFisher; Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Mammalian Expression, Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38521067

Proper citation: RRID:Addgene_211115 Copy   


http://www.addgene.org/215038

Species: Homo sapiens
Genetic Insert: twist family bHLH transcription factor 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5366; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38262408

Proper citation: RRID:Addgene_215038 Copy   


http://www.addgene.org/214620

Species: Synthetic
Genetic Insert: 10x clustered UAS element with barcode 0382
Vector Backbone Description: Vector Backbone:pGL4; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38635397

Proper citation: RRID:Addgene_214620 Copy   


  • RRID:Addgene_193658

http://www.addgene.org/193658

Species: Synthetic
Genetic Insert: RVR-dLbCas12a-hA3A-Y130F, EGFP
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36323848

Proper citation: RRID:Addgene_193658 Copy   


  • RRID:Addgene_195555

http://www.addgene.org/195555

Species: Synthetic
Genetic Insert: mWasabi
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pETDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35708251

Proper citation: RRID:Addgene_195555 Copy   


http://www.addgene.org/188186

Species: Mus musculus
Genetic Insert: anti-Homer1 (Mus musculus) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2916214. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.

Proper citation: RRID:Addgene_188186 Copy   


  • RRID:Addgene_210550

http://www.addgene.org/210550

Species: Other
Genetic Insert: CLV3p::spCas9::PEA3At::U6p::AAVS1gRNA::pHTR5::LT2::mCherrySSM
Vector Backbone Description: Vector Backbone:pSUN; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37403571

Proper citation: RRID:Addgene_210550 Copy   


http://www.addgene.org/215043

Species: Homo sapiens
Genetic Insert: twist family bHLH transcription factor 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5366; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38262408

Proper citation: RRID:Addgene_215043 Copy   


http://www.addgene.org/215042

Species: Homo sapiens
Genetic Insert: twist family bHLH transcription factor 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5366; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38262408

Proper citation: RRID:Addgene_215042 Copy   


  • RRID:Addgene_215680

http://www.addgene.org/215680

Species: Synthetic
Genetic Insert: eef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
Vector Backbone Description: Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38351905

Proper citation: RRID:Addgene_215680 Copy   


http://www.addgene.org/215045

Species: Homo sapiens
Genetic Insert: twist family bHLH transcription factor 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5366; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38262408

Proper citation: RRID:Addgene_215045 Copy   


  • RRID:Addgene_195554

http://www.addgene.org/195554

Species: Synthetic
Genetic Insert: mWasabi
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pETDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35708251

Proper citation: RRID:Addgene_195554 Copy   


http://www.addgene.org/215044

Species: Homo sapiens
Genetic Insert: twist family bHLH transcription factor 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5366; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38262408

Proper citation: RRID:Addgene_215044 Copy   


  • RRID:Addgene_210553

http://www.addgene.org/210553

Species: Other
Genetic Insert: pU6::AAVS1gRNA::LT2::mCherrySSM
Vector Backbone Description: Vector Backbone:pSUN; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37403571

Proper citation: RRID:Addgene_210553 Copy   


  • RRID:Addgene_210551

http://www.addgene.org/210551

Species: Other
Genetic Insert: pU6::AAVS1gRNA::LT0::mCherrySSM
Vector Backbone Description: Vector Backbone:pSUN; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37403571

Proper citation: RRID:Addgene_210551 Copy   


  • RRID:Addgene_210552

http://www.addgene.org/210552

Species: Other
Genetic Insert: pU6::AAVS1gRNA::LT1::mCherrySSM
Vector Backbone Description: Vector Backbone:pSUN; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37403571

Proper citation: RRID:Addgene_210552 Copy   


  • RRID:Addgene_215331

http://www.addgene.org/215331

Species: Mus musculus
Genetic Insert: 131-2a_LC
Vector Backbone Description: Backbone Size:5038; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40693554
Comments: Please visit https://doi.org/10.1101/2025.01.04.631317 for bioRxiv preprint.

Proper citation: RRID:Addgene_215331 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Kravitz Dataset1 Resources

    Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within Kravitz that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X