Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: neuronal differentiation 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5366; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38262408
Proper citation: RRID:Addgene_215031 Copy
Species: Acidaminococcus
Genetic Insert: denAsCas12a
Vector Backbone Description: Backbone Marker:Mario Capecchi; Vector Backbone:Addgene plasmid # 133568; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38760567
Comments: Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint.
Proper citation: RRID:Addgene_217333 Copy
Species: Homo sapiens
Genetic Insert: twist family bHLH transcription factor 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5366; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38262408
Proper citation: RRID:Addgene_215034 Copy
Species: Synthetic
Genetic Insert: GFPmut2
Vector Backbone Description: Backbone Size:3968; Vector Backbone:pSC101; Vector Types:Bacterial Expression, reporter; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38519558
Proper citation: RRID:Addgene_208191 Copy
Species: Homo sapiens
Genetic Insert: 5' C-term Top2A homology arm
Vector Backbone Description: Backbone Marker:ThermoFisher; Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Mammalian Expression, Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38521067
Proper citation: RRID:Addgene_211115 Copy
Species: Homo sapiens
Genetic Insert: twist family bHLH transcription factor 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5366; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38262408
Proper citation: RRID:Addgene_215038 Copy
Species: Synthetic
Genetic Insert: 10x clustered UAS element with barcode 0382
Vector Backbone Description: Vector Backbone:pGL4; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38635397
Proper citation: RRID:Addgene_214620 Copy
Species: Synthetic
Genetic Insert: RVR-dLbCas12a-hA3A-Y130F, EGFP
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36323848
Proper citation: RRID:Addgene_193658 Copy
Species: Synthetic
Genetic Insert: mWasabi
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pETDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35708251
Proper citation: RRID:Addgene_195555 Copy
Species: Mus musculus
Genetic Insert: anti-Homer1 (Mus musculus) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2916214. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_188186 Copy
Species: Other
Genetic Insert: CLV3p::spCas9::PEA3At::U6p::AAVS1gRNA::pHTR5::LT2::mCherrySSM
Vector Backbone Description: Vector Backbone:pSUN; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37403571
Proper citation: RRID:Addgene_210550 Copy
Species: Homo sapiens
Genetic Insert: twist family bHLH transcription factor 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5366; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38262408
Proper citation: RRID:Addgene_215043 Copy
Species: Homo sapiens
Genetic Insert: twist family bHLH transcription factor 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5366; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38262408
Proper citation: RRID:Addgene_215042 Copy
Species: Synthetic
Genetic Insert: eef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
Vector Backbone Description: Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38351905
Proper citation: RRID:Addgene_215680 Copy
Species: Homo sapiens
Genetic Insert: twist family bHLH transcription factor 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5366; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38262408
Proper citation: RRID:Addgene_215045 Copy
Species: Synthetic
Genetic Insert: mWasabi
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pETDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35708251
Proper citation: RRID:Addgene_195554 Copy
Species: Homo sapiens
Genetic Insert: twist family bHLH transcription factor 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5366; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38262408
Proper citation: RRID:Addgene_215044 Copy
Species: Other
Genetic Insert: pU6::AAVS1gRNA::LT2::mCherrySSM
Vector Backbone Description: Vector Backbone:pSUN; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37403571
Proper citation: RRID:Addgene_210553 Copy
Species: Other
Genetic Insert: pU6::AAVS1gRNA::LT0::mCherrySSM
Vector Backbone Description: Vector Backbone:pSUN; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37403571
Proper citation: RRID:Addgene_210551 Copy
Species: Other
Genetic Insert: pU6::AAVS1gRNA::LT1::mCherrySSM
Vector Backbone Description: Vector Backbone:pSUN; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37403571
Proper citation: RRID:Addgene_210552 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within Kravitz that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.