Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCAGGS/EG5-RBD Resource Report Resource Website |
RRID:Addgene_213410 | pCAGGS/EG5-RBD | Ampicillin | PMID:38405707 | Backbone Size:4745; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | G339H,R346T,L368I,S371F,S373P,S375F,T376A,D405N,R408S,K417N,N440K,V445P,G446S, F456L,N460K,S477N,T478K,E484A,F486P,F490S,Q498R,N501Y,Y505H | 2026-09-12 02:40:18 | 0 | ||
|
pαH-S-GSAS-2P-Omicron-BA.5 Resource Report Resource Website |
RRID:Addgene_213828 | pαH-S-GSAS/Omicron-2P-BA5 | Ampicillin | PMID:38405707 | A portion of this plasmid was derived from a plasmid made by Jason McLellan; Terms and Licences: UBMTA, Not available to Industry; see this as a reference: https://www.addgene.org/164566/ | Backbone Size:4746; Vector Backbone:pαH; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | G339D,R346T,S371F,S373P,S375F,T376A,D405N,R408S,K417N,N440K,L452R, S477N,T478K,E484A,F486V,Q498R,N501Y,Y505H,H655Y,N679K,P681H,N764K,D796Y,Q954H,N969K, K986P, V987P | 2026-09-12 02:40:18 | 0 | |
|
pEGFP-C1-deltaExon16-17 Resource Report Resource Website |
RRID:Addgene_209564 | Shtn1 long isoform with E16-17 deletion | Mus musculus | Kanamycin | PMID:30733148 | Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Exon16 and 17 deletion | 2026-09-12 02:40:17 | 0 | |
|
pLV-SFFV-ZFYVE27 S14D S25D S32D T261D-WPRE-UbC-mCherry Resource Report Resource Website |
RRID:Addgene_214471 | ZFYVE27 | Homo sapiens | Ampicillin | Vector Backbone:pHRsinUbEm; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | S14D S25D S32D T261D | 2026-09-12 02:40:18 | 0 | ||
|
pGS400_myc-8xGCN4-T2A-BSD Lenti Resource Report Resource Website |
RRID:Addgene_211885 | 8xGCN4pep | Synthetic | Ampicillin | Vector Backbone:pLenti; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | N/A | 2026-09-12 02:40:18 | 0 | ||
|
pGS398_myc-4xGCN4-T2A-BSD Lenti Resource Report Resource Website |
RRID:Addgene_211883 | 4xGCN4pep | Synthetic | Ampicillin | Vector Backbone:pLenti; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | N/A | 2026-09-12 02:40:18 | 0 | ||
|
pLKO.1-GST-EGFP-GPIBY55 Resource Report Resource Website |
RRID:Addgene_213717 | EGFP | Homo sapiens | Ampicillin | PMID:36250010 | Vector Backbone:pLKO.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:18 | 0 | ||
|
pFlare9A-Clip2E9 Mutant Resource Report Resource Website |
RRID:Addgene_209575 | Clip2 | Mus musculus | Kanamycin | PMID:30733148 | Vector Backbone:pFlare9A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | ACGCGTTTCTGAATTCTTCTAACTGCCCTCAAATGCACGGTGGCATGTGCACAGGCACACATACTAAATGAATAAATAAAATGCACCTAACAAACAAAGAAAGACTGACTCTTTAAATCCCACAAAGGAAGAAACTGGGGTACCCATAGCCACTGCGTTATCAGAGGCTGGCAAGGGGTGGTTCCCAGAGCCTCTTCTGCCTTGAACACACGCCCAGCTAGCCCCAGTGATGGGAGGGCACCCAGGAGAAAGCAATTCCGGCTCATTGAAGTCTTGTTCACGGAAGATGACGCACGGAATATTCCTTTCCCCACGTCCCTGCCTTCCCTGTCCACCCTGCCATCCCTCCCCCACCCCCGCCCTGGGTGGAGCAGACCCAGACCCAGCTGGAGCACGCGCGCATTGGGGAGCTGGAGCAGAGCCTGCTATTGGAGAAGGCGCAGGCCGAGCGGCTGCTCAGAGAATTAGCGGATAACAGGGTAAACCGCGCCTGCCACTGTCACCCACCCGGCCAGCGCCTTGGCCCCTAGATGCCCCCTTTGCTTTTTAAATCATTTCCTCTGCCATCACAATGGCTCCTCTTACTATTGCTTTTTGGAGACCCTTCTGAACTCCCCTCTGGGAGGGAAGCTGAGATTTAGAGTCAAGCTCACTGTGGCCAAGTAGTGCTCTTAGGGAAGGGGGGTTTGGTCCTCTGGGATTTCTTCCAAGTTCATTGCTCCTTGAGCAGAGGTGTCTCTGTGAGACCTTCCCTGTGCCTCCCTCCTGTCCCTTGCCAGAAAGAAGCCTTCTTGGAGTGGCCTGCCCCTTACTTGGATAGACATGGGCTTCCTTGGCAGGAATGCAGACCCAGAGTGTTCTAGCCTAGAGAATCTTAAGATGGCAGCAGAGAGCCAACCTGGAGGACGGATCCATAGTCGACC | 2026-09-12 02:40:18 | 0 | |
|
pEM7067 Resource Report Resource Website 1+ mentions |
RRID:Addgene_214005 | eGFP-AAV | Synthetic | Ampicillin | PMID:38589953 | Vector Backbone:pKH70-PrpsM; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:18 | 1 | ||
|
pEM7069 Resource Report Resource Website 1+ mentions |
RRID:Addgene_214007 | mScarlet-I-AAV | Synthetic | Ampicillin | PMID:38589953 | Vector Backbone:pKH70-PrpsM; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:18 | 1 | ||
|
pEM7070 Resource Report Resource Website 1+ mentions |
RRID:Addgene_214008 | mNeonGreen-ASV | Synthetic | Ampicillin | PMID:38589953 | Vector Backbone:pKH70-PrpsM; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:18 | 1 | ||
|
pEM7071 Resource Report Resource Website 1+ mentions |
RRID:Addgene_214009 | mScarlet-I-ASV | Synthetic | Ampicillin | PMID:38589953 | Vector Backbone:pKH70-PrpsM; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:18 | 1 | ||
|
pEM7063 Resource Report Resource Website 1+ mentions |
RRID:Addgene_214001 | eGFP-LVA | Synthetic | Ampicillin | PMID:38589953 | Vector Backbone:pKH70-PrpsM; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:18 | 1 | ||
|
pEM7064 Resource Report Resource Website 1+ mentions |
RRID:Addgene_214002 | mNeonGreen-LVA | Synthetic | Ampicillin | PMID:38589953 | Vector Backbone:pKH70-PrpsM; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:18 | 1 | ||
|
pEM7065 Resource Report Resource Website 1+ mentions |
RRID:Addgene_214003 | mCerulean-LVA | Synthetic | Ampicillin | PMID:38589953 | Vector Backbone:pKH70-PrpsM; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:18 | 1 | ||
|
pAAV2_hSyn_NES-Caprola_05-mEGFP_WRPE-SV40 Resource Report Resource Website |
RRID:Addgene_194689 | Caprola_05-mEGFP | Synthetic | Ampicillin | PMID:38386755 | Backbone Size:4200; Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:19 | 0 | ||
|
pLKO.1-scrCdh10.1 GFP Resource Report Resource Website |
RRID:Addgene_209102 | scrCdh10.1 | Ampicillin | PMID:37707499 | Vector Backbone:pLKO.1; Vector Types:; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:19 | 0 | |||
|
pLKO.1-scrCdh11.1 GFP Resource Report Resource Website |
RRID:Addgene_209104 | scrCdh11.1 | Ampicillin | PMID:37707499 | Vector Backbone:pLKO.1; Vector Types:; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:19 | 0 | |||
|
pDonor-Prf1-ires-mCherry Resource Report Resource Website |
RRID:Addgene_209073 | Prf1-ires-mCherry HDR template (parts of Prf1 with mutated PAM) | Mus musculus | Ampicillin | PMID:38306418 | Backbone Size:3155; Vector Backbone:pDonor; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:19 | 0 | ||
|
pDonor-Prf1-mock-ires-mCherry Resource Report Resource Website |
RRID:Addgene_209074 | Prf1-mock-ires-mCherry HDR template (parts of Prf1(S399Stop) with mutated PAM) | Mus musculus | Ampicillin | PMID:38306418 | Backbone Size:3155; Vector Backbone:pDonor; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:19 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.