Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: MAD2BP1
Vector Backbone Description: Vector Backbone:pCMV4-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37468549
Comments: This is a mutated version of plasmid #221697.
Proper citation: RRID:Addgene_221698 Copy
Species: Other
Genetic Insert: IL6
Vector Backbone Description: Backbone Marker:Andrew S. Flies Lab; Vector Backbone:pAF138; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39017897
Comments: Plasmid generated by Gibson assembly using NotI and SmaI sites.
Proper citation: RRID:Addgene_222388 Copy
Species: Homo sapiens
Genetic Insert: MAD2BP1
Vector Backbone Description: Vector Backbone:pCMV4-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37468549
Proper citation: RRID:Addgene_221697 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Andrew S. Flies Lab; Vector Backbone:pAF137; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39017897
Comments: Plasmid generated by Gibson assembly using NotI and SmaI sites.
Proper citation: RRID:Addgene_222389 Copy
Species: Homo sapiens
Genetic Insert: MAD2
Vector Backbone Description: Vector Backbone:pCMV4-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37468549
Proper citation: RRID:Addgene_221696 Copy
Species: E. coli
Genetic Insert: Genotype: F’[traD36 lacIq lacZ ∆M15 proA+B+] glnV (supE) thi-1 ∆(mcrB-hsdSM)5 (rK- mK- McrB-) ∆(lac-proAB) ulaD::M13
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:38499480
Comments: Primers for validation
Pair 1: agtaaggacgcgccatgaaa + agcgaaagacagcatcggaa (Ta = 59 C, should have 2526 bp product)
Pair 2: aatcggttgaatgtcgccct + gggaaacgacgatgagcaga (Ta = 59, should have 3900 bp product)
Proper citation: RRID:Addgene_220921 Copy
Vector Backbone Description: Vector Backbone:DVK; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39801078
Proper citation: RRID:Addgene_217586 Copy
Species: Homo sapiens
Genetic Insert: RNA binding fox-1 homolog 2
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37640841
Proper citation: RRID:Addgene_224292 Copy
Vector Backbone Description: Vector Backbone:DVK; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39801078
Proper citation: RRID:Addgene_217584 Copy
Vector Backbone Description: Vector Backbone:DVC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39801078
Proper citation: RRID:Addgene_217588 Copy
Species: Homo sapiens
Genetic Insert: RNF8
Vector Backbone Description: Vector Backbone:pcDNA4.1/TO/myc-HisA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37468549
Comments: This is a mutated version of plasmid #221676.
Proper citation: RRID:Addgene_221680 Copy
Species: Homo sapiens
Genetic Insert: RNF8
Vector Backbone Description: Vector Backbone:pcDNA4.1/TO/myc-HisA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37468549
Comments: This is a mutated version of plasmid #221676.
Proper citation: RRID:Addgene_221681 Copy
Species: Homo sapiens
Genetic Insert: RNF8
Vector Backbone Description: Vector Backbone:pcDNA3.1 mycBioID; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37468549
Comments: This is a mutated version of plasmid #221683.
Proper citation: RRID:Addgene_221684 Copy
Species: Caenorhabditis elegans
Genetic Insert: sra-6
Vector Backbone Description: Vector Backbone:pPD95.62; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33378642
Proper citation: RRID:Addgene_223468 Copy
Species: Homo sapiens
Genetic Insert: RNF8
Vector Backbone Description: Vector Backbone:pcDNA3.1 mycBioID; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37468549
Comments: This is a mutated version of plasmid #221683.
Proper citation: RRID:Addgene_221685 Copy
Vector Backbone Description: Vector Backbone:DVC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39801078
Proper citation: RRID:Addgene_217597 Copy
Vector Backbone Description: Vector Backbone:DVC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39801078
Proper citation: RRID:Addgene_217598 Copy
Vector Backbone Description: Vector Backbone:DVC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39801078
Proper citation: RRID:Addgene_217599 Copy
Species: Homo sapiens
Genetic Insert: NKX2-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:37994369
Comments: Cloning based on backbone of 371AA short isoform of NKX2-1 ORF
Proper citation: RRID:Addgene_221473 Copy
Species: Synthetic
Genetic Insert: SNAP-tag
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDisplay; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34777770
Proper citation: RRID:Addgene_223495 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within Kravitz that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
