Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 113 showing 2241 ~ 2260 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/209026

Species: Synthetic
Genetic Insert: intergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
Vector Backbone Description: Vector Backbone: pLCHKOv3; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794

Proper citation: RRID:Addgene_209026 Copy   


http://www.addgene.org/209786

Species: Synthetic
Genetic Insert: TNT4, TadA8e, SpRY N, inteinN
Vector Backbone Description: Backbone Size:7172; Vector Backbone:pAAV-CMV-TadA8e-SpG N aa2-713-InteinN; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38805581
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.06.29.546982v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_209786 Copy   


http://www.addgene.org/209032

Species: Synthetic
Genetic Insert: hgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
Vector Backbone Description: Vector Backbone: pLCHKOv3; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794

Proper citation: RRID:Addgene_209032 Copy   


http://www.addgene.org/209033

Species: Synthetic
Genetic Insert: hgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
Vector Backbone Description: Vector Backbone: pLCHKOv3; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794

Proper citation: RRID:Addgene_209033 Copy   


  • RRID:Addgene_209034

http://www.addgene.org/209034

Vector Backbone Description: Vector Backbone: pLCHKOv3; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Comments: Carrying ccdB gene as stuffer that is replaced during guide cloning. After cloning guides, use NEB Stable bacterial growth strains to amplify plasmid.

Proper citation: RRID:Addgene_209034 Copy   


  • RRID:Addgene_209035

http://www.addgene.org/209035

Vector Backbone Description: Vector Backbone: pLCHKOv3; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Comments: Carrying ccdB gene as stuffer that is replaced during guide cloning. After cloning guides, use NEB Stable bacterial growth strains to amplify plasmid.

Proper citation: RRID:Addgene_209035 Copy   


  • RRID:Addgene_210254

http://www.addgene.org/210254

Species: Aequorea victoria
Genetic Insert: mCerulean
Vector Backbone Description: Backbone Marker:Host-Microbe Interactions lab; Vector Backbone:pUdO1a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38235654

Proper citation: RRID:Addgene_210254 Copy   


  • RRID:Addgene_210650

http://www.addgene.org/210650

Species: Synthetic
Genetic Insert: V3-FETCH1
Vector Backbone Description: Vector Backbone:pJL1; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38979618
Comments: Gibson cloning used NdeI (5') and SalI (3') sites

Proper citation: RRID:Addgene_210650 Copy   


http://www.addgene.org/210651

Species: Synthetic
Genetic Insert: sFLAG-p5-PRB4_R7-9-FETCH1
Vector Backbone Description: Vector Backbone:pJL1; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38979618
Comments: Gibson cloning used NdeI (5') and SalI (3') sites

Proper citation: RRID:Addgene_210651 Copy   


  • RRID:Addgene_209319

    This resource has 1+ mentions.

http://www.addgene.org/209319

Species: Homo sapiens
Genetic Insert: APOBEC1-YTH-HA
Vector Backbone Description: Backbone Marker:Gift from Minmin Luo's lab; Backbone Size:5436; Vector Backbone:CAG-EGFP; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39009472
Comments: 5' cloning sites:EGFP_P2A_clone_F: gcatggacgagctgtacaaggccactaacttctccctP2A_clone_F: gccactaacttctccctgttgaaacaagcaggggatgtcgaagagaatcccgggccaP2A_APOBEC1_clone_F: gaagagaatcccgggccaatgagctcagagactggccc3' cloning site:WPRE-HindIII-SD-HA-clone-R: tccagaggttgattatcgataagcttttaggcgtagtcgggcacgtcgt Please visit https://www.biorxiv.org/content/10.1101/2023.12.06.570314v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_209319 Copy   


http://www.addgene.org/210824

Species: Synthetic
Genetic Insert: mTagBFP2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5228; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39168849
Comments: Please visit https://doi.org/10.1101/2023.11.08.566258 for bioRxiv preprint.

Proper citation: RRID:Addgene_210824 Copy   


http://www.addgene.org/209037

Species: Synthetic
Genetic Insert: intergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
Vector Backbone Description: Vector Backbone:pLCHKOv3-Cherry; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794

Proper citation: RRID:Addgene_209037 Copy   


http://www.addgene.org/209039

Species: Streptococcus pyogenes
Genetic Insert: APOBEC1-nSpCas9
Vector Backbone Description: Backbone Marker:Addgene #87360; Vector Backbone:TLCV2 inducible lentiviral plasmid; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794

Proper citation: RRID:Addgene_209039 Copy   


  • RRID:Addgene_209043

http://www.addgene.org/209043

Species: Streptococcus pyogenes
Genetic Insert: nSpCas9
Vector Backbone Description: Backbone Marker:Addgene #87360; Vector Backbone:TLCV2 inducible lentiviral plasmid; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794

Proper citation: RRID:Addgene_209043 Copy   


  • RRID:Addgene_209044

    This resource has 1+ mentions.

http://www.addgene.org/209044

Species: Streptococcus pyogenes
Genetic Insert: TadA8e-nSpCas9
Vector Backbone Description: Backbone Marker:Addgene #87360; Vector Backbone:TLCV2 inducible lentiviral plasmid; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794

Proper citation: RRID:Addgene_209044 Copy   


  • RRID:Addgene_210143

http://www.addgene.org/210143

Species: Saccharomyces cerevisiae
Genetic Insert: YIp ADE2-LEU2 pTDH3::ARO7-GFP::tADH1
Vector Backbone Description: Vector Backbone:pRH3022; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37729018

Proper citation: RRID:Addgene_210143 Copy   


  • RRID:Addgene_209046

http://www.addgene.org/209046

Vector Backbone Description: Backbone Marker:Addgene #73311; Vector Backbone:pLCKO; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794

Proper citation: RRID:Addgene_209046 Copy   


  • RRID:Addgene_209042

    This resource has 1+ mentions.

http://www.addgene.org/209042

Species: Streptococcus pyogenes
Genetic Insert: evoCDA1-nSpCas9
Vector Backbone Description: Backbone Marker:Addgene #87360; Vector Backbone:TLCV2 inducible lentiviral plasmid; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794

Proper citation: RRID:Addgene_209042 Copy   


  • RRID:Addgene_210821

    This resource has 1+ mentions.

http://www.addgene.org/210821

Species: Homo sapiens
Genetic Insert: Prominin 1
Vector Backbone Description: Backbone Marker:Nathan D. Lawson; Backbone Size:4072; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39168849
Comments: Please visit https://doi.org/10.1101/2023.11.08.566258 for bioRxiv preprint. Original construct published in: Hori, A., Nishide, K., Yasukuni, Y., Haga, K., Kakuta, W., Ishikawa, Y., Hayes, M.J., Ohnuma, S., Kiyonari, H., Kimura, K., et al. (2019). Prominin-1 Modulates Rho/ROCK-Mediated Membrane Morphology and Calcium-Dependent Intracellular Chloride Flux. Sci. Rep. 9, 15911. 10.1038/s41598-019-52040-9.

Proper citation: RRID:Addgene_210821 Copy   


http://www.addgene.org/210822

Species: Homo sapiens
Genetic Insert: Prominin 1
Vector Backbone Description: Backbone Marker:Nathan D. Lawson; Backbone Size:4072; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39168849
Comments: Please visit https://doi.org/10.1101/2023.11.08.566258 for bioRxiv preprint. Original construct published in: Hori, A., Nishide, K., Yasukuni, Y., Haga, K., Kakuta, W., Ishikawa, Y., Hayes, M.J., Ohnuma, S., Kiyonari, H., Kimura, K., et al. (2019). Prominin-1 Modulates Rho/ROCK-Mediated Membrane Morphology and Calcium-Dependent Intracellular Chloride Flux. Sci. Rep. 9, 15911. 10.1038/s41598-019-52040-9.

Proper citation: RRID:Addgene_210822 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Kravitz Dataset1 Resources

    Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within Kravitz that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X