Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 110 showing 2181 ~ 2200 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/207071

Species: Saccharomyces cerevisiae
Genetic Insert: Vrg4
Vector Backbone Description: Vector Backbone:ClhN-URA; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35727034

Proper citation: RRID:Addgene_207071 Copy   


http://www.addgene.org/209021

Species: Acidaminococcus sp
Genetic Insert: enCas12a-2xNLS-Myc-NeoR
Vector Backbone Description: Backbone Marker:Addgene #155046; Vector Backbone:plenti-Lb-Cas12a-2xNLS; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794

Proper citation: RRID:Addgene_209021 Copy   


  • RRID:Addgene_207083

http://www.addgene.org/207083

Species: Homo sapiens
Genetic Insert: HaloTag followed by BGH PolyA and PuroR cassette flanked by human RNF169 locus sequences
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pFastBac dual; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699

Proper citation: RRID:Addgene_207083 Copy   


http://www.addgene.org/208172

Species: Schizosaccharomyces pombe
Genetic Insert: N-terminal WD40 domain of yeast α-COPI(1-327);six substitutions(Arg13Ala, Leu181Lys, Leu185Lys, Ile192Lys, Leu196Lys, Phe197Lys)
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38102143

Proper citation: RRID:Addgene_208172 Copy   


http://www.addgene.org/206717

Species: Mus musculus
Genetic Insert: anti-Nav1.7 Na+ channel (Homo sapiens) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2941288. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute

Proper citation: RRID:Addgene_206717 Copy   


  • RRID:Addgene_207089

http://www.addgene.org/207089

Species: Homo sapiens
Genetic Insert: ATCATTAAGTACTAGACTCA
Vector Backbone Description: Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699

Proper citation: RRID:Addgene_207089 Copy   


http://www.addgene.org/208341

Species: Schizosaccharomyces pombe
Genetic Insert: N-terminal WD40 domain of yeast α-COPI (1-327) with substitutions (Leu181Lys, Leu185Lys, Ile192Lys, Leu196Lys and Phe197Lys)
Vector Backbone Description: Vector Backbone:pSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38102143

Proper citation: RRID:Addgene_208341 Copy   


http://www.addgene.org/207011

Species: Saccharomyces cerevisiae
Genetic Insert: Pho8
Vector Backbone Description: Vector Backbone:BS-TRP1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34088313

Proper citation: RRID:Addgene_207011 Copy   


  • RRID:Addgene_207010

http://www.addgene.org/207010

Species: Saccharomyces cerevisiae
Genetic Insert: YPQ2
Vector Backbone Description: Vector Backbone:KT209; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34088313

Proper citation: RRID:Addgene_207010 Copy   


  • RRID:Addgene_207097

http://www.addgene.org/207097

Species: Homo sapiens
Genetic Insert: TTTCTAAAGGCTGAATGAAA
Vector Backbone Description: Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699

Proper citation: RRID:Addgene_207097 Copy   


  • RRID:Addgene_207251

http://www.addgene.org/207251

Species: Mus musculus
Genetic Insert: iNos Promoter
Vector Backbone Description: Backbone Marker:Trono Lab; Backbone Size:7388; Vector Backbone:pRRLSIN.cPPT.PGK-GFP.WPRE; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37091169
Comments: To generate the iNos-eGFP plasmid, a 1825 -bp XhoI/BamHI fragment was isolated from a ppGL2-NOS2 Promoter-Luciferase construct (Addgene plasmid # 19296, deposited by Charles Lowenste). The iNos fragment was subcloned into the lentiviral construct pRRLSIN.cPPT.PGK-GFP.WPRE (Addgene plasmid #12252, deposited by Didier Trono to generate a PER2-luciferase reporter construct.

Proper citation: RRID:Addgene_207251 Copy   


http://www.addgene.org/206604

Species: Mus musculus
Genetic Insert: anti-Kvbeta1.2/KCNAB1 K+ channel (Homo sapiens) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2941177. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute

Proper citation: RRID:Addgene_206604 Copy   


  • RRID:Addgene_208748

http://www.addgene.org/208748

Genetic Insert: CEL-Frb-EGFP-HOTag3
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37521779

Proper citation: RRID:Addgene_208748 Copy   


http://www.addgene.org/208628

Species: Homo sapiens
Genetic Insert: human RPL3 (ENST00000216146) aa 1~41
Vector Backbone Description: Vector Backbone:pET28-mEGFP(A206K)-TwStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_208628 Copy   


http://www.addgene.org/208749

Species: Homo sapiens
Genetic Insert: ZIF-NLS-EGFP(Y66F)-HOTag6
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37521779

Proper citation: RRID:Addgene_208749 Copy   


http://www.addgene.org/206606

Species: Mus musculus
Genetic Insert: anti-CASPR2 (Homo sapiens) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2941179. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute

Proper citation: RRID:Addgene_206606 Copy   


  • RRID:Addgene_208744

http://www.addgene.org/208744

Genetic Insert: CEL-eGFP-HoTag3
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37521779

Proper citation: RRID:Addgene_208744 Copy   


  • RRID:Addgene_208745

http://www.addgene.org/208745

Genetic Insert: ZIF-eGFP-HoTag6
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37521779

Proper citation: RRID:Addgene_208745 Copy   


http://www.addgene.org/208625

Species: Homo sapiens
Genetic Insert: human RPL3 (ENST00000216146) aa 72~197
Vector Backbone Description: Vector Backbone:pET28-mEGFP(A206K)-TwStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_208625 Copy   


  • RRID:Addgene_208746

http://www.addgene.org/208746

Species: Homo sapiens
Genetic Insert: CEL-IFP2-SOScat
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37521779

Proper citation: RRID:Addgene_208746 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Kravitz Dataset1 Resources

    Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within Kravitz that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X