Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Vector Backbone:T7-pAc5.1 mCherry EcoRV; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38570497
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_206445 Copy
Species: Homo sapiens
Genetic Insert: MDM2 1-118
Vector Backbone Description: Vector Backbone:T6-pAc5.1 mEGFP-EcoRV; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38570497
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_206444 Copy
Species: Homo sapiens
Genetic Insert: FKBP12
Vector Backbone Description: Vector Backbone:HK049-pAc5.1 PH mcherry FspAI; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38570497
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_206459 Copy
Species: Drosophila melanogaster
Genetic Insert: Cup
Vector Backbone Description: Vector Backbone:JM050-pAc5.1 PH mEGFP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38570497
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_206451 Copy
Species: Homo sapiens
Genetic Insert: p53 1-50
Vector Backbone Description: Vector Backbone:HK049-pAc5.1 PH mcherry FspAI; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38570497
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_206458 Copy
Species: Drosophila melanogaster
Genetic Insert: NOT3
Vector Backbone Description: Vector Backbone:HK049-pAc5.1 PH mcherry FspAI; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38570497
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_206457 Copy
Species: Drosophila melanogaster
Genetic Insert: NOT2
Vector Backbone Description: Vector Backbone:HK049-pAc5.1 PH mcherry FspAI; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38570497
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_206456 Copy
Species: Drosophila melanogaster
Genetic Insert: Oskar 139-606
Vector Backbone Description: Vector Backbone:HK049-pAc5.1 PH mcherry FspAI; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38570497
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_206460 Copy
Species: Oryza sativa
Genetic Insert: Os Tir1
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_204602 Copy
Genetic Insert: Candida glabrata ERG11
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_204603 Copy
Species: Oryza sativa
Genetic Insert: Os Tir1
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_204601 Copy
Vector Backbone Description: Vector Backbone:Synthetic; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_204050 Copy
Vector Backbone Description: Vector Backbone:XH26-pAc5.1 OST4 mcherry EcoRV; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38570497
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_206475 Copy
Species: Drosophila melanogaster
Genetic Insert: CCR4
Vector Backbone Description: Vector Backbone:EB03-pAc5.1 FspAI mcherry PH ; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38570497
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_206473 Copy
Species: Mus musculus
Genetic Insert: Period 2
Vector Backbone Description: Backbone Marker:Alexeyev Lab; Backbone Size:8331; Vector Backbone:pMA3160; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30943793
Comments: For generation of PER2-luciferase (PER2:Luc) plasmid, a 159-bp EcoRI/NotI fragment was isolated from a pGL3 basic PER2 construct, obtained from Addgene (plasmid #48747, deposited by Dr Joseph Takahashi). The PER2 promoter-containing fragment was subcloned into the lentiviral construct pMA3160 (Addgene plasmid #35043, deposited by Dr Mikhail Alexeyev) to generate a PER2-luciferase reporter construct.
Proper citation: RRID:Addgene_206875 Copy
Vector Backbone Description: Vector Backbone:pAc5.1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38570497
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_206481 Copy
Vector Backbone Description: Vector Backbone:T8-pAC5.1 lambda N HA EcoRV; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38570497
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_206493 Copy
Species: Homo sapiens
Genetic Insert: HaloTag-MDC1 PST deletion
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pHTN HaloTag CMV-neo (Promega; #G7721); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699
Proper citation: RRID:Addgene_207109 Copy
Species: Homo sapiens
Genetic Insert: ATGGCAGGACTATGGCAGCC
Vector Backbone Description: Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699
Proper citation: RRID:Addgene_207101 Copy
Species: Mus musculus
Genetic Insert: anti-Olig1 (Mus musculus) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2941227. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute
Proper citation: RRID:Addgene_206656 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within Kravitz that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
