Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00029256
Proper Citation: RRID:WB-STRAIN:WBStrain00029256
Description: Caenorhabditis elegans with name tmem-107(oq100) I. from WB.
Species: Caenorhabditis elegans
Synonyms: tmem-107(oq100) I.
Notes: F39B2.9/TMEM-107 has been shown to control the localization of 4 peripheral ciliary transition zone proteins. tmem-107(oq100); nphp-4(tm925) double mutants display ultra-structural malformations in ciliary transition zones, and exhibit sensory abnormalities including roaming, chemoattractant, and dye-filling defects. TRAM-1::tdTomato leaks into cilia in oq100 mutants. Genotyping primers: Forward cgcggttcttcttgtttctt, Reverse wildtype gagatcgagacggcgacg, Reverse oq100 gaaaaacaacgtggaagtcca. Reference: Lambacher NJ, et al. Nat Cell Biol. 2016 Jan;18(1):122-31.
Affected Gene: WBGene00043308(tmem-107)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for OEB800.
No alerts have been found for OEB800.
Source: Integrated Animals
Source Database: WormBase (WB)
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
