Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
YG1011 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040718 | Caenorhabditis elegans | baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); qIs19 V. | qIs19 [lag-2p::GFP::unc-54 3'UTR + rol-6(su1006)] V. Heterozygotes are Rollers with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, and non-GFP gk324 homozygotes (Sterile and Unc). All worms express lag-2p::GFP at the distal tip cells. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. | WBGene00000235(baf-1)|WBGene00000254(bli-4)|WBGene00001578(ges-1)|WBGene00002246(lag-2)|WBGene00003514(myo-2)|WBGene00003983(pes-10) | WBGene00000235(baf-1), WBGene00000254(bli-4), WBGene00001578(ges-1), WBGene00002246(lag-2), WBGene00003514(myo-2), WBGene00003983(pes-10) | WB-STRAIN:WBStrain00040718 | WormBase (WB) | WB | available | WB-STRAIN:YG1011, CGC_YG1011 | 2026-08-08 10:16:12 | 0 | |||
|
YG1021 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040720 | Caenorhabditis elegans | baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); ccIs4810 X. | ccIs4810 [(pJKL380.4) lmn-1p::lmn-1::GFP::lmn-1 3'utr + (pMH86) dpy-20(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile and Unc). All worms express Cel-lamin::GFP (lmn-1 gene is expressed at the nuclear periphery). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. | WBGene00000235(baf-1)|WBGene00000254(bli-4)|WBGene00001578(ges-1)|WBGene00003052(lmn-1)|WBGene00003514(myo-2)|WBGene00003983(pes-10) | WBGene00000235(baf-1), WBGene00000254(bli-4), WBGene00001578(ges-1), WBGene00003052(lmn-1), WBGene00003514(myo-2), WBGene00003983(pes-10) | WB-STRAIN:WBStrain00040720 | WormBase (WB) | WB | available | WB-STRAIN:YG1021, CGC_YG1021 | 2026-08-08 10:16:12 | 0 | |||
|
JU617 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00041121 | Caenorhabditis briggsae | EMPTY | Non-elegans Strain | WBGene00003514(myo-2)|WBGene00028342(Cbr-lin-3) | WBGene00003514(myo-2), WBGene00028342(Cbr-lin-3) | WB-STRAIN:WBStrain00041121 | WormBase (WB) | WB | unknown | WB-STRAIN:JU617 | 2026-08-08 10:16:17 | 0 | |||
|
JU616 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00041120 | Caenorhabditis briggsae | EMPTY | Non-elegans Strain | WBGene00003514(myo-2)|WBGene00028342(Cbr-lin-3) | WBGene00003514(myo-2), WBGene00028342(Cbr-lin-3) | WB-STRAIN:WBStrain00041120 | WormBase (WB) | WB | unknown | WB-STRAIN:JU616 | 2026-08-08 10:16:17 | 0 | |||
|
JU610 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00041118 | Caenorhabditis briggsae | EMPTY | Non-elegans Strain | WBGene00003514(myo-2)|WBGene00030012(Cbr-egl-17) | WBGene00003514(myo-2), WBGene00030012(Cbr-egl-17) | WB-STRAIN:WBStrain00041118 | WormBase (WB) | WB | unknown | WB-STRAIN:JU610 | 2026-08-08 10:16:17 | 0 | |||
|
JU613 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00041119 | Caenorhabditis briggsae | EMPTY | Non-elegans Strain | WBGene00003514(myo-2)|WBGene00030720(Cbr-zmp-1) | WBGene00003514(myo-2), WBGene00030720(Cbr-zmp-1) | WB-STRAIN:WBStrain00041119 | WormBase (WB) | WB | unknown | WB-STRAIN:JU613 | 2026-08-08 10:16:17 | 0 | |||
|
VC307 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035666 | Caenorhabditis elegans | kin-1(ok338)/mIs13 I. | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK909.2a. mIs13 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] I. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP (stronger signal represents mIs13 homozygotes, weaker signal represents ok338/mIs13) and non-GFP ok338 homozygotes (arrested embryos). Pick dim GFP WT and check for correct segregation of progeny to maintain." | WBGene00002189(kin-1)|WBGene00003514(myo-2)|WBGene00003983(pes-10) | WBGene00002189(kin-1), WBGene00003514(myo-2), WBGene00003983(pes-10) | WB-STRAIN:WBStrain00035666 | WormBase (WB) | WB | available | WB-STRAIN:VC307, CGC_VC307 | 2026-08-08 10:15:06 | 0 | |||
|
RG3036 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033362 | Caenorhabditis elegans | irg-7(ve536[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 5265 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ccTTAGTTGTTGATACAGTAGACACCTCCA ; Right flanking sequence: GCTACAATTGTAACGTAGTCAACGCTAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 5265 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ccTTAGTTGTTGATACAGTAGACACCTCCA ; Right flanking sequence: GCTACAATTGTAACGTAGTCAACGCTAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of irg-7. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ccTTAGTTGTTGATACAGTAGACACCTCCA Right flanking sequence: GCTACAATTGTAACGTAGTCAACGCTAAGA" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00018237(irg-7) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00018237(irg-7) | WB-STRAIN:WBStrain00033362 | WormBase (WB) | WB | available | WB-STRAIN:RG3036, CGC_RG3036 | 2026-08-08 10:14:32 | 0 | |||
|
RG3039 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033365 | Caenorhabditis elegans | spe-36(ve539[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49] IV; +/nT1 V. | F40F11.4. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, lays only oocytes. Deletion of 2632 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste GFP+ non-mKate2 (ve539 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcacaaaaactcacAAATAACTTTGTACCG ; Right flanking sequence: ACGCAAGAGCTATGAAGAACAGAATACATA. sgRNA #1: acAAATAACTTTGTACCGGG; sgRNA #2: CTTCATAGCTCTTGCGTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of F40F11.4. Insertion site verified by PCR. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, ve539 homozygotes (Ste, lays only oocytes, GFP+ mKate-), Vul nT1 homozygotes (brighter mKate2+) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: aaaactcacAAATAACTTTGTACCG Right flanking sequence: ACGCAAGAGCTATGAAGAACAGAAT" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00009589(spe-36) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00009589(spe-36) | WB-STRAIN:WBStrain00033365 | WormBase (WB) | WB | available | WB-STRAIN:RG3039, CGC_RG3039 | 2026-08-08 10:14:32 | 0 | |||
|
RG3041 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033366 | Caenorhabditis elegans | K06A9.3(ve541[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tgtcagaatcacaaaaaattatgttttttt ; Right flanking sequence: GGAGGGGCACATAGAATCAATCATGCGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of K06A9.3. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: gaatcacaaaaaattatgttttttt Right flanking sequence: GGAGGGGCACATAGAATCAATCATG" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033366 | WormBase (WB) | WB | available | WB-STRAIN:RG3041, CGC_RG3041 | 2026-08-08 10:14:32 | 0 | |||
|
RG3020 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033347 | Caenorhabditis elegans | sra-24(ve520[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1150 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGAAGGTCTCACCAATGCATTGACCTCGA ; Right flanking sequence: CTTGGCGTTAATTATTTGAGAATATTCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1150 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CCGAAGGTCTCACCAATGCATTGACCTCGA ; Right flanking sequence: CTTGGCGTTAATTATTTGAGAATATTCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-39. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: TGAATTCGGTCTTGCCTCTTTTTTCCTAAC Right flanking sequence: TGAGGTACCTTGAAAAATAATAGCAAATAA" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005050(sra-24)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005050(sra-24), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033347 | WormBase (WB) | WB | available | WB-STRAIN:RG3020, CGC_RG3020 | 2026-08-08 10:14:32 | 0 | |||
|
RG3021 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033348 | Caenorhabditis elegans | sra-33(ve521[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 2545 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcatcaaaatTCATTTATTCCACAT ; Right flanking sequence: gcacaaataatatgtgaaaaggggaacctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 2545 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aaaaatcatcaaaatTCATTTATTCCACAT ; Right flanking sequence: gcacaaataatatgtgaaaaggggaacctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-33. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: aaaaatcatcaaaatTCATTTATTCCACAT Right flanking sequence: gcacaaataatatgtgaaaaggggaacctt" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005059(sra-33)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005059(sra-33), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033348 | WormBase (WB) | WB | available | WB-STRAIN:RG3021, CGC_RG3021 | 2026-08-08 10:14:32 | 0 | |||
|
RG3022 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033349 | Caenorhabditis elegans | sra-21(ve522[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1748 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagagcagaaaccacacatctgctcacaga ; Right flanking sequence: tctggactgttattgaaagttttacgggtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1748 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tagagcagaaaccacacatctgctcacaga ; Right flanking sequence: tctggactgttattgaaagttttacgggtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-21. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: tagagcagaaaccacacatctgctcacaga Right flanking sequence: tctggactgttattgaaagttttacgggtg" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005047(sra-21)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005047(sra-21), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033349 | WormBase (WB) | WB | available | WB-STRAIN:RG3022, CGC_RG3022 | 2026-08-08 10:14:32 | 0 | |||
|
RG3015 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033342 | Caenorhabditis elegans | sra-12(ve515[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1064 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTATTAGTGGAGCCAGAGAAACACAGGCA ; Right flanking sequence: CACGGGTACTTATTAATGGATAACACGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1064 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AGTATTAGTGGAGCCAGAGAAACACAGGCA ; Right flanking sequence: CACGGGTACTTATTAATGGATAACACGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-12. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: AGTATTAGTGGAGCCAGAGAAACACAGGCA Right flanking sequence: CACGGGTACTTATTAATGGATAACACGAGG" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005038(sra-12)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005038(sra-12), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033342 | WormBase (WB) | WB | available | WB-STRAIN:RG3015, CGC_RG3015 | 2026-08-08 10:14:32 | 0 | |||
|
RG3018 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033345 | Caenorhabditis elegans | sra-39(ve518[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 2040 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAATTCGGTCTTGCCTCTTTTTTCCTAAC ; Right flanking sequence: TGAGGTACCTTGAAAAATAATAGCAAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 2040 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TGAATTCGGTCTTGCCTCTTTTTTCCTAAC ; Right flanking sequence: TGAGGTACCTTGAAAAATAATAGCAAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Emily Lorenz-Mueller"|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-39. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: TGAATTCGGTCTTGCCTCTTTTTTCCTAAC Right flanking sequence: TGAGGTACCTTGAAAAATAATAGCAAATAA" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005065(sra-39)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005065(sra-39), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033345 | WormBase (WB) | WB | available | WB-STRAIN:RG3018, CGC_RG3018 | 2026-08-08 10:14:32 | 0 | |||
|
RG3019 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033346 | Caenorhabditis elegans | sra-32(ve519[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtcaaatatgttccagtttttataccactc ; Right flanking sequence: ggtggttttgattattaatgggagcaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: gtcaaatatgttccagtttttataccactc ; Right flanking sequence: ggtggttttgattattaatgggagcaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-9. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ttcagtttcaagatttcATGGCTACCATAG Right flanking sequence: ataggctgaaccaaaaaagtacatcgagtt" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005058(sra-32)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005058(sra-32), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033346 | WormBase (WB) | WB | available | WB-STRAIN:RG3019, CGC_RG3019 | 2026-08-08 10:14:32 | 0 | |||
|
RG3031 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033358 | Caenorhabditis elegans | F53C11.9(ve531[LoxP+ myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR +LoxP]) V. | Homozygous viable. Deletion of 349 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aattctcattgagaacatttcaacacacaa ; Right flanking sequence: CAAGGATTTGTTGTTGATTCAAATACCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 349 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aattctcattgagaacatttcaacacacaa ; Right flanking sequence: CAAGGATTTGTTGTTGATTCAAATACCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of F53C11.9. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: aattctcattgagaacatttcaacacacaa Right flanking sequence: CAAGGATTTGTTGTTGATTCAAATACCAAA" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033358 | WormBase (WB) | WB | available | WB-STRAIN:RG3031, CGC_RG3031 | 2026-08-08 10:14:32 | 0 | |||
|
RG3027 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033354 | Caenorhabditis elegans | C40H5.2(ve527[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 1675 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ccaggcaatgatcaacgATGTACGCCTTAT ; Right flanking sequence: TCTGGAAGATCTTGAAGACTCTGCCATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1675 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ccaggcaatgatcaacgATGTACGCCTTAT ; Right flanking sequence: TCTGGAAGATCTTGAAGACTCTGCCATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C40H5.2. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ccaggcaatgatcaacgATGTACGCCTTAT Right flanking sequence: TCTGGAAGATCTTGAAGACTCTGCCATTCT" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033354 | WormBase (WB) | WB | available | WB-STRAIN:RG3027, CGC_RG3027 | 2026-08-08 10:14:32 | 0 | |||
|
RG3028 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033355 | Caenorhabditis elegans | C40H5.7(ve528[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTGTGAGCGAATTGTTAAATGGAGTGGCTT ; Right flanking sequence: atcacatgtcatatacagtattccattaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CTGTGAGCGAATTGTTAAATGGAGTGGCTT ; Right flanking sequence: atcacatgtcatatacagtattccattaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C40H5.7. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: CTGTGAGCGAATTGTTAAATGGAGTGGCTT Right flanking sequence: atcacatgtcatatacagtattccattaaa" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033355 | WormBase (WB) | WB | available | WB-STRAIN:RG3028, CGC_RG3028 | 2026-08-08 10:14:32 | 0 | |||
|
RG3030 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033357 | Caenorhabditis elegans | C46F4.3(ve530[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 794 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCTTACTTTCCGTTTCTGCAAAACAAGTG ; Right flanking sequence: GGAGGAGTCTGCAGACCGTCGACAAAGTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 794 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATCTTACTTTCCGTTTCTGCAAAACAAGTG ; Right flanking sequence: GGAGGAGTCTGCAGACCGTCGACAAAGTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C46F4.3. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ATCTTACTTTCCGTTTCTGCAAAACAAGTG Right flanking sequence: GGAGGAGTCTGCAGACCGTCGACAAAGTGC" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033357 | WormBase (WB) | WB | available | WB-STRAIN:RG3030, CGC_RG3030 | 2026-08-08 10:14:32 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the ASWG Community.
Our Information
