Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 1 showing 1 ~ 20 out of 1,464 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:RGD_13207522

The record is no longer available at this source.

Source Database: RGD, Rat Genome Database Strain List RGD
Genetic Background: mutant
Affected Genes: (null)
Genomic Alteration: (null)
Availability: Not Available
References:
Synonyms:
Alternate IDs:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Tert gene of Crl:SD rat embryos. The resulting mutation is a 17-bp deletion of exon1 in Tert gene. MCW Gene Editing Rat Resource Center This is a legacy resource.

Proper citation: RRID:RGD_13207522 Copy   


  • RRID:RGD_11537344

The record is no longer available at this source.

Source Database: RGD, Rat Genome Database Strain List RGD
Genetic Background: mutant
Affected Genes: (null)
Genomic Alteration: (null)
Availability: Not Available
References:
Synonyms:
Alternate IDs:
Notes: The CRISPR/Cas9 genome editing system was used to generate this mutant rat strain. It inserted 55-79 copies of human premutation CGG repeats of the FMR1 gene into rat Fmr1. The recipient zygotes were from inbred strain F344 at RRRC. Rat Resource and Research Center This is a legacy resource.

Proper citation: RRID:RGD_11537344 Copy   


  • RRID:RGD_13208586

The record is no longer available at this source.

Source Database: RGD, Rat Genome Database Strain List RGD
Genetic Background: mutant
Affected Genes: (null)
Genomic Alteration: (null)
Availability: Not Available
References:
Synonyms:
Alternate IDs:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 2 of the Avpr2 gene. MCW Gene Editing Rat Resource Center This is a legacy resource.

Proper citation: RRID:RGD_13208586 Copy   


  • RRID:RGD_13208585

The record is no longer available at this source.

Source Database: RGD, Rat Genome Database Strain List RGD
Genetic Background: mutant
Affected Genes: (null)
Genomic Alteration: (null)
Availability: Not Available
References:
Synonyms:
Alternate IDs:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in Exon 2 of the Avpr2 gene. MCW Gene Editing Rat Resource Center This is a legacy resource.

Proper citation: RRID:RGD_13208585 Copy   


http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=401900746

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-11-21)
References:
Synonyms:
Alternate IDs: RGD_401900746
Notes: CRISPR/Cas9 system was used to introduce Cre recombinase downstream of the Prl7b1 start site. Rat Resource and Research Center

Proper citation: 001013 Copy   


  • RRID:RRRC_01025

http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=616335891

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2025-05-13)
References:
Synonyms:
Alternate IDs: RGD_616335891
Notes: Exons 2 and 3 were deleted to eliminate all known Synaptopodin isoforms in the outbred Long Evans (Charles River 006). It is similar to RRRC strain #964 (LE-Synpoem1Kmh) (RGD:155782907), has a different mutation location upstream of exon 2. This strain is deposited at Rat Resource and Research Center

Proper citation: 001025 Copy   


  • RRID:RRRC_01007

http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=401827145

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryorecovery (as of 2025-01-27)
References:
Synonyms:
Alternate IDs: RGD_401827145
Notes: The CRISPR-Cas9 system was used to delete the coding region (exons 1-8) of the Pink1 gene in NTac:SD embryos. The rat is deposited at Rat Resource and Research Center (RRRC). Rat Resource and Research Center

Proper citation: 001007 Copy   


  • RRID:RGD_2314655

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314655

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-06-21)
References:
Synonyms:
Alternate IDs: 2314655
Notes: Hereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988. Harlan

Proper citation: RRID:RGD_2314655 Copy   


  • RRID:RGD_2314230

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314230

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm
References:
Synonyms: , Hanako
Alternate IDs: 2314230
Notes: A mutant rat showing abnormal skin phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_2314230 Copy   


  • RRID:RGD_2314365

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314365

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm
References:
Synonyms:
Alternate IDs: 2314365
Notes: A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_2314365 Copy   


  • RRID:RGD_4139880

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139880

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 4139880
Notes: This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5.

Proper citation: RRID:RGD_4139880 Copy   


  • RRID:RGD_4139883

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139883

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 4139883
Notes: This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7.

Proper citation: RRID:RGD_4139883 Copy   


  • RRID:RGD_4139885

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139885

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 4139885
Notes: This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2.

Proper citation: RRID:RGD_4139885 Copy   


  • RRID:RGD_2325754

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2325754

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 2325754
Notes: Autosomal dominant mutation that arose spontaneously in SD rats. Genomic DNA analysis from mutants revealed a single base(G) insertion in the exon generating a novel 5' donor splice site. This led to the internal a 602-bp deletion of Pax6 mRNA.

Proper citation: RRID:RGD_2325754 Copy   


  • RRID:RGD_4142546

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4142546

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo
References:
Synonyms:
Alternate IDs: 4142546
Notes: Rats which showed a dental mutation such as morphological abnormalities of the teeth were found in the SHR-SP rats at Daiichi Seiyaku, Co., Ltd. in 1981. Transferred to Tokushima University in 2003. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_4142546 Copy   


  • RRID:RGD_5131920

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131920

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Alternate IDs: 5131920
Notes: This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 2.

Proper citation: RRID:RGD_5131920 Copy   


  • RRID:RGD_5131921

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131921

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Alternate IDs: 5131921
Notes: This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2.

Proper citation: RRID:RGD_5131921 Copy   


  • RRID:RGD_5143989

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5143989

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 5143989
Notes: This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 84-bp mutation deleting part of exon 3 and the splice acceptor.

Proper citation: RRID:RGD_5143989 Copy   


  • RRID:RGD_5143984

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5143984

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 5143984
Notes: This strain was produced by injecting ZFNs targeting the sequence CCTCTGCCCAGCTACgtcatcTCCCCGGTGGCCCCCGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6.

Proper citation: RRID:RGD_5143984 Copy   


  • RRID:RGD_5143987

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5143987

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 5143987
Notes: This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2.

Proper citation: RRID:RGD_5143987 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. ScreenIT Resources

    Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within ASWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X