Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
pha-1(e2123) III; otEx7647. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050870 | Caenorhabditis elegans | pha-1(e2123) III; otEx7647. | Made_by: Cyril Cros|"otEx7647 [ttll-9p(500 bp)::GFP + pha-1(+)]. Maintain at 25C to retain array. OLQ neurons are marked with GFP. Can be used to isolate OLQ by FACS. Used by CeNGEN project for RNA-Seq (https:" | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050870 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:27 | 0 | ||||
|
C. briggsae wild isolate. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050877 | Caenorhabditis briggsae | C. briggsae wild isolate. | Made_by: Andrs Fodor|"no longer available from the CGC."|"PB420 is derived from C. briggsae Gujarat, the strain that later was named G16 and then AF16. PB420 was frozen (as C. briggsae Gujarat) 22 March 1991, thawed 15 June 2020 and sent to the CGC 1 July 2020. It may be considered ancestral to AF16 and was renamed to distinguish it from AF16 strains that have been maintained in laboratory cultures. Reference: Fodor A, et al. Nematologica 1983 92: 203-217. doi:10/1163.187529283X00456" | WB-STRAIN:WBStrain00050877 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:27 | 0 | ||||||
|
oac-59(sy1260) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050910 | Caenorhabditis elegans | oac-59(sy1260) IV. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-59; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CCACCGTCTTCAAAACGGCTGGACCTTCAAGGCAT. Right flanking sequence: TAGAGGGTTGGCAATTCTATCAGTTCTGGGATTTCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGGACCTTCAAGGCATTAGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00016585(oac-59) | WBGene00016585(oac-59) | WB-STRAIN:WBStrain00050910 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:28 | 0 | ||||
|
pha-1(e2123) III; otEx7568. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050875 | Caenorhabditis elegans | pha-1(e2123) III; otEx7568. | Made_by: Robert W Fernandez (Hobert Lab)|"otEx7568 [nlp-17::GFP + pha-1(+)]. Maintain at 25C to retain array. PVQ neurons marked with GFP. Can be used to isolate PVQ by FACS. Used by CeNGEN project for RNA-Seq (https:" | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050875 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
pha-1(e2123) III; otEx7693. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050874 | Caenorhabditis elegans | pha-1(e2123) III; otEx7693. | Made_by: Oliver Hobert Lab|"otEx7693 [F23H12.7p(RIM)::tagRFP + pha-1(+)]. Maintain at 25C to retain array. RIM neurons marked with RFP. Can be used to isolate RIM by FACS. Used by CeNGEN project for RNA-Seq (https:" | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050874 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:27 | 0 | ||||
|
nas-38(syb293) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050878 | Caenorhabditis elegans | nas-38(syb293) X. | Increased lethargus duration and increased movement quiescence during lethargus. syb293 is a clean C-terminal deletion starting from the same position where nas-38(ok3407) is truncated, removes a large part of the TSP domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791|"Made_by: SunyBiotech" | WBGene00003554(nas-38) | WBGene00003554(nas-38) | WB-STRAIN:WBStrain00050878 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
oac-52(sy1290) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050918 | Caenorhabditis elegans | oac-52(sy1290) IV. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-52; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CTTCAAGGTATTCGAGGTCTTGCTATTACAGTTGTRight flanking sequence: ACTAGGTTTTCATTTCTATCCAGAAGCTTTTCCCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTTGCTATTACAGTTGTACTMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00020977(oac-52) | WBGene00020977(oac-52) | WB-STRAIN:WBStrain00050918 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:28 | 0 | ||||
|
oac-34(sy1288) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050917 | Caenorhabditis elegans | oac-34(sy1288) I. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-34; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: gCTTCTTTGTGATCTCCGGTTACCTGATGGCCCGTA.Right flanking sequence: ACCTGACACACATGAAAATCTCCAAAATCAGTGACinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTTCATGTGTGTCAGGTTACMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00010157(oac-34) | WBGene00010157(oac-34) | WB-STRAIN:WBStrain00050917 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
oac-22(sy1286) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050916 | Caenorhabditis elegans | oac-22(sy1286) IV. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-22; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CACGCGTTACTTTTTGTGTCAAACAGACCAAAAARight flanking sequence: CTGTGGCAGAGGACTATTTTACAATGgtaggtgctginserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTCAAACAGACCAAAAACTGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00018142(oac-22) | WBGene00018142(oac-22) | WB-STRAIN:WBStrain00050916 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:28 | 0 | ||||
|
srw-54(sy1234) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050903 | Caenorhabditis elegans | srw-54(sy1234) V. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srw-54; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: TTTGGTACGATCTGCAAAACATCATCAGGCCTATTRight flanking sequence: GATGTGTACTTGGATTACTTCAACTTTTCAATATCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAATCCAAGTACACATCAATMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00005801(srw-54) | WBGene00005801(srw-54) | WB-STRAIN:WBStrain00050903 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:27 | 0 | ||||
|
fox-1(ot1081[fox-1::gfp::3xflag]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050869 | Caenorhabditis elegans | fox-1(ot1081[fox-1::gfp::3xflag]) X. | Made_by: Veronika Solianova|"Superficially wild-type." | WBGene00001484(fox-1) | WBGene00001484(fox-1) | WB-STRAIN:WBStrain00050869 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
srw-36(sy1248) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050906 | Caenorhabditis elegans | srw-36(sy1248) V. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srw-36; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CAATTGACTGTTAACCAATTTCTGATAGGTATCGTAGTRight flanking sequence: TTGTGGGATTATCCACAATGTATGTAGTATCATCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGATAGGTATCGTAGTTTGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00005783(srw-36) | WBGene00005783(srw-36) | WB-STRAIN:WBStrain00050906 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:27 | 0 | ||||
|
oac-24(sy1246) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050905 | Caenorhabditis elegans | oac-24(sy1246) V. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-24; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: aaaaaatttcagATTCTTTGTCATTTCCGGATACCRight flanking sequence: TCATGGCGAAAAATTTAACGAAGACTAAACTTTCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGTCATTTCCGGATACCTCAMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00018211(oac-24) | WBGene00018211(oac-24) | WB-STRAIN:WBStrain00050905 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
oac-38(sy1256) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050908 | Caenorhabditis elegans | oac-38(sy1256) IV. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-38; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GTTTTAGGATTTCACTTCCTGCCAGATGTATTTCCRight flanking sequence: TAATGGATACTTAGGAGTTGATCAgtaagttttcaacinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGCCAGATGTATTTCCTAAMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00010392(oac-38) | WBGene00010392(oac-38) | WB-STRAIN:WBStrain00050908 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
pha-4(ot946[pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050851 | Caenorhabditis elegans | pha-4(ot946[pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]) V. | GFP tag inserted at the C-terminus of the endogenous pha-4 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. Please contact Oliver Hobert prior to publishing work using this strain.|"Made_by: Eduardo Leyva-Diaz" | WBGene00004013(pha-4) | WBGene00004013(pha-4) | WB-STRAIN:WBStrain00050851 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
daf-16(ot853[daf-16::mNG::AID]) I; daf-2(e1370) III; otIs730. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050850 | Caenorhabditis elegans | daf-16(ot853[daf-16::mNG::AID]) I; daf-2(e1370) III; otIs730. | otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted | WBGene00000898(daf-2)|WBGene00000912(daf-16) | WBGene00000898(daf-2), WBGene00000912(daf-16) | WB-STRAIN:WBStrain00050850 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:27 | 0 | ||||
|
pha-1(e2123) III; otEx7419. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050855 | Caenorhabditis elegans | pha-1(e2123) III; otEx7419. | Made_by: Chen Wang (Hobert Lab)|"otEx7419 [mgl-1p::GFP + pha-1(+)]. GFP expression labels 4 of the 6 RMD neurons (RMDD and RMDV pairs, but not RMDL/R pair). Maintain at 25C to retain array." | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050855 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:27 | 0 | ||||
|
nIs107 III; zfIs10 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050858 | Caenorhabditis elegans | nIs107 III; zfIs10 IV. | nIs107 [tbh-1::GFP] III. zfIs10 [tdc-1::mCherry] IV. RIC neurons are marked with both GFP and mCherry. | WB-STRAIN:WBStrain00050858 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:27 | 0 | ||||||
|
wrm-1(st12263[wrm-1::TY1::EGFP::3xFLAG]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051012 | Caenorhabditis elegans | wrm-1(st12263[wrm-1::TY1::EGFP::3xFLAG]) III. | CRISPR/Cas9 engineered tagged endogenous locus.|"Made_by: DKV/LS/CK" | WBGene00006943(wrm-1) | WBGene00006943(wrm-1) | WB-STRAIN:WBStrain00051012 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:29 | 0 | ||||
|
col-88(sy1512) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050965 | Caenorhabditis elegans | col-88(sy1512) III. | Made_by: Heenam Park/Mandy Tan/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-88. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: CTATCCTTATCGGTACCCAGGTGATCCTCTCCACCGright flanking sequence: CTATCCTTGGCTCCCTGCTCTACGCCGGTGTCCTCinserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGGGAGCCAAGGATAGCGGMethod Reference: G3 (Bethesda)." | WBGene00000663(col-88) | WBGene00000663(col-88) | WB-STRAIN:WBStrain00050965 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the ASWG Community.
Our Information
