Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
lucEx825. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050754 | Caenorhabditis elegans | lucEx825. | lucEx825 [tbx-34::T2A::GFP::H2B::tbx-34 3'UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Wild-type morphology. Extrachromosomal tbx-34 reporter includes 755 bp of tbx-34 upstream region and 4.4 kb of downstream region. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421|"Made_by: Julien Charest" | WB-STRAIN:WBStrain00050754 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:25 | 0 | ||||||
|
lucEx824. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050753 | Caenorhabditis elegans | lucEx824. | lucEx824 [mab-9::T2A::GFP::H2B::mab-9 3'UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Wild-type morphology. Extrachromosomal mab-9 reporter includes 3.1 kb of mab-9 upstream region and 1.5 kb of downstream region. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421|"Made_by: Julien Charest" | WB-STRAIN:WBStrain00050753 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:25 | 0 | ||||||
|
tbx-37(tm314) tbx-38(tm581)/qC1[dpy-19(e1259) glp-1(q339) qIs26] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050740 | Caenorhabditis elegans | tbx-37(tm314) tbx-38(tm581)/qC1[dpy-19(e1259) glp-1(q339) qIs26] III. | qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygote animals show roller phenotype and express GFP in the distal tip cells. Segregate roller and GFP(+) heterozygotes, embryonic lethal qC1 homozygotes and embryonic lethal tbx-37/38 homozygotes. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421 | WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00006556(tbx-37)|WBGene00006557(tbx-38) | WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00006556(tbx-37), WBGene00006557(tbx-38) | WB-STRAIN:WBStrain00050740 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||
|
nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X, lucIs24. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050744 | Caenorhabditis elegans | nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X, lucIs24. | lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Pick GFP+ animals to maintain balanced line. Balanced mir-51 family mutant expressing a mirtron-version of mir-51. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested nT1[qIs51] aneuploids, and non-GFP mir-51 family homozygous mutants. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Non-GFP mir-51 family homozygous mutants rescued by mirtron-51 transgene are viable, but slow-growing and sick. Strain is derived from injection into parental strain MT17143. lucIs24 is a spontaneous integrant originating from a complex extra-chromosomal array, the genomic location of the transgene is unknown. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.|"Made_by: Philipp Dexheimer" | WBGene00003280(mir-52) | WBGene00003280(mir-52) | WB-STRAIN:WBStrain00050744 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:25 | 0 | ||||
|
lucSi100 II; unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050748 | Caenorhabditis elegans | lucSi100 II; unc-119(ed3) III. | lucSi100 [hsp16.41::vhhGFP4::zif-1::SL2::mCherry::his-11::tbb-2 3'UTR] II. Superficially wild-type morphology. Single-copy insertion of a GFP-nanobody::zif-1 fusion transgene under a heat-shock promoter for timely controlled degradation of GFP-tagged proteins (Wang et al. (2017). A toolkit for GFP-mediated tissue-specific protein degradation in C. elegans. Development 144, 2694-2701.) | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00050748 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:25 | 0 | ||||
|
pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050747 | Caenorhabditis elegans | pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. | ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous pash-1 tagged with the auxin-inducible-degron (AID) peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.|"Made_by: Philipp Dexheimer" | WBGene00006843(unc-119)|WBGene00011908(pash-1) | WBGene00006843(unc-119), WBGene00011908(pash-1) | WB-STRAIN:WBStrain00050747 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:25 | 0 | ||||
|
dhs-28(ldr6) X; ldrIs1; ldrIs2. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050738 | Caenorhabditis elegans | dhs-28(ldr6) X; ldrIs1; ldrIs2. | ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr6 is G-to-A causing a G158E substitution. Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The G158E substitution site of the ldr6 mutant is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276|"ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr6 is G158A (Gly-Arg). Super-sized lipid droplets. Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276" | WBGene00000991(dhs-28) | WBGene00000991(dhs-28) | WB-STRAIN:WBStrain00050738 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:25 | 0 | ||||
|
pha-1(e2123) III; otEx7225. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050843 | Caenorhabditis elegans | pha-1(e2123) III; otEx7225. | otEx7225 [eat-5(fosmid WRM0621dG04)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050843 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:26 | 0 | ||||
|
otIs439; hdIs32. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050842 | Caenorhabditis elegans | otIs439; hdIs32. | Made_by: Oliver Hobert Lab|"otIs439 [lad-2p::GFP + pha-1(+)]. hdIs32 [glr-1::DsRed2]. SMD neurons are labeled with GFP and DsRed2. Can be used to isolate SMD by FACS. Used by CeNGEN project for RNA-Seq (https:" | WB-STRAIN:WBStrain00050842 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||||
|
pha-1(e2123) III; otEx7121. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050841 | Caenorhabditis elegans | pha-1(e2123) III; otEx7121. | otEx7121 [inx-3(fosmid WRM0636dA10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050841 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:26 | 0 | ||||
|
pha-1(e2123) III; otEx7292. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050848 | Caenorhabditis elegans | pha-1(e2123) III; otEx7292. | otEx7292 [inx-7(fosmid WRM0631dH08)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050848 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
inx-2(ot906 [inx-2::SL2::NLS::yfp::H2B]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050847 | Caenorhabditis elegans | inx-2(ot906 [inx-2::SL2::NLS::yfp::H2B]) X. | inx-2(ot906) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-2 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. | WBGene00002124(inx-2) | WBGene00002124(inx-2) | WB-STRAIN:WBStrain00050847 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:27 | 0 | ||||
|
pha-1(e2123) III; otEx7233. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050846 | Caenorhabditis elegans | pha-1(e2123) III; otEx7233. | otEx7233 [inx-19(extended fosmid WRM0632bE10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050846 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:27 | 0 | ||||
|
pha-1(e2123) III; otEx7232. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050845 | Caenorhabditis elegans | pha-1(e2123) III; otEx7232. | otEx7232 [inx-15(fosmid WRM0619cH12)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050845 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
otEx7294. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050849 | Caenorhabditis elegans | otEx7294. | otEx7294 [inx-8(fosmid WRM0632dA04)::SL2::NLS::YFP::H2B + rol-6(su1006)]. Pick Rollers to maintain. | WB-STRAIN:WBStrain00050849 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:27 | 0 | ||||||
|
pha-1(e2123) III; otEx7113. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050838 | Caenorhabditis elegans | pha-1(e2123) III; otEx7113. | otEx7113 [inx-12(fosmid WRM0621dC07)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050838 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:26 | 0 | ||||
|
Y55B1BR.1(sy1201) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050890 | Caenorhabditis elegans | Y55B1BR.1(sy1201) III. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55B1BR.1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CCGTACCCGTAGAATGCTTGAAGAAATGGCCGGCCRight flanking sequence: TCGTGGGAACTAAACCATTGAGCCAGCTTCCTCGAAGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAAGAAATGGCCGGCCTCGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00021911(affl-1) | WBGene00021911(affl-1) | WB-STRAIN:WBStrain00050890 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
nlp-77(sy1216) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050895 | Caenorhabditis elegans | nlp-77(sy1216) II. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-77; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GACAACCAGCCGGAGGTCAAGATGTTCCACCATTCRight flanking sequence: CTTCGTAATGCCACTCCAGCTCAACTTCAGAGCTTCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGTGGCATTACGAAGGAAMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WB-STRAIN:WBStrain00050895 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:27 | 0 | ||||||
|
nlp-76(sy1214) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050894 | Caenorhabditis elegans | nlp-76(sy1214) X. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-76; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: cagTGTTCATCGCAATCTGCGTGCTCTCCCAAAARight flanking sequence: CGCTATGGCCCTCCGTGGTGCACTATTCCGTTCTGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CACGGAGGGCCATAGCGTTTMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00045386(nlp-76) | WBGene00045386(nlp-76) | WB-STRAIN:WBStrain00050894 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:27 | 0 | ||||
|
pals-16(sy1207) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050892 | Caenorhabditis elegans | pals-16(sy1207) III. | Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GGAATCATTGACAAATTGCAGAACATCAACACCTTRight flanking sequence: Ggtaggttgaagaagttattattggaatttgaaatinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAGAACATCAACACCTTGGTMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00022337(pals-16) | WBGene00022337(pals-16) | WB-STRAIN:WBStrain00050892 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:27 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.