Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP::AID]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050823 | Caenorhabditis elegans | daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP::AID]) X. | Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID conditional daf-12 allele in daf-7(e1372) background (TIR1-less control). Reference: Aghayeva et al., submitted | WBGene00000903(daf-7)|WBGene00000908(daf-12) | WBGene00000903(daf-7), WBGene00000908(daf-12) | WB-STRAIN:WBStrain00050823 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:26 | 0 | ||||
|
pha-1(e2123) III; otEx7092. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050829 | Caenorhabditis elegans | pha-1(e2123) III; otEx7092. | otEx7092 [inx-18b(fosmid WRM0629cH03)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050829 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:26 | 0 | ||||
|
pha-1(e2123) III; otEx7075. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050827 | Caenorhabditis elegans | pha-1(e2123) III; otEx7075. | otEx7075 [inx-18a(fosmid WRM0629cH03)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00050827 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||
|
cle-1(qy22[cle-1::mNG+loxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050770 | Caenorhabditis elegans | cle-1(qy22[cle-1::mNG+loxP]) I. | Made_by: Qiuyi Chi, Daniel Keeley,Eric Hastie, Ranjay Jayad|"Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing." | WBGene00000527(cle-1) | WBGene00000527(cle-1) | WB-STRAIN:WBStrain00050770 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||
|
sdn-1(qy29[sdn-1::mNG+loxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050774 | Caenorhabditis elegans | sdn-1(qy29[sdn-1::mNG+loxP]) X. | Made_by: Qiuyi Chi, Daniel Keeley,Eric Hastie, Ranjay Jayad|"SDN-1::mNG endogenous tag"|"Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing." | WBGene00004749(sdn-1) | WBGene00004749(sdn-1) | WB-STRAIN:WBStrain00050774 | WormBase (WB) | WB | unknown | PMID:37039075 PMID:38964319 |
2026-08-01 10:23:25 | 0 | |||
|
emb-9(qy24[emb-9::mNG+loxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050771 | Caenorhabditis elegans | emb-9(qy24[emb-9::mNG+loxP]) III. | Made_by: Qiuyi Chi, Daniel Keeley,Eric Hastie, Ranjay Jayad|"Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing." | WBGene00001263(emb-9) | WBGene00001263(emb-9) | WB-STRAIN:WBStrain00050771 | WormBase (WB) | WB | unknown | PMID:38964319 | 2026-08-01 10:23:25 | 0 | |||
|
mig-6(qy37[mNG+loxP::mig-6]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050777 | Caenorhabditis elegans | mig-6(qy37[mNG+loxP::mig-6]) V. | Made_by: Qiuyi Chi, Daniel Keeley,Eric Hastie, Ranjay Jayad|"Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. mNeonGreen is inserted at the N-terminus right before a putative proprotein convertase cleavage site and Western analysis indicates most of the mNeonGreen is cut from the MIG-1 protein and is diffuse in the extracellular fluid. See Figure S1 in Keeley et al., Dev Cell. 2020 Jul 6;54(1):60-74.e7. doi: 10.1016/j.devcel.2020.05.022. PMID: 32585132" | WBGene00003242(mig-6) | WBGene00003242(mig-6) | WB-STRAIN:WBStrain00050777 | WormBase (WB) | WB | unknown | PMID:38964319 | 2026-08-01 10:23:25 | 0 | |||
|
inx-6(ot804 [inx-6::SL2::NLS::yfp::H2B]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050810 | Caenorhabditis elegans | inx-6(ot804 [inx-6::SL2::NLS::yfp::H2B]) IV. | inx-6(ot804) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-6 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. | WBGene00002128(inx-6) | WBGene00002128(inx-6) | WB-STRAIN:WBStrain00050810 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:26 | 0 | ||||
|
him-4(qy33[him-4::mNG+loxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050775 | Caenorhabditis elegans | him-4(qy33[him-4::mNG+loxP]) X. | Made_by: Qiuyi Chi, Daniel Keeley,Eric Hastie, Ranjay Jayad|"Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing." | WBGene00001863(him-4) | WBGene00001863(him-4) | WB-STRAIN:WBStrain00050775 | WormBase (WB) | WB | unknown | PMID:38964319 | 2026-08-01 10:23:25 | 0 | |||
|
daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; daf-2(e1370) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050815 | Caenorhabditis elegans | daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; daf-2(e1370) III. | Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background (TIR1-less control). Reference: Aghayeva et al., submitted | WBGene00000898(daf-2)|WBGene00000912(daf-16) | WBGene00000898(daf-2), WBGene00000912(daf-16) | WB-STRAIN:WBStrain00050815 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||
|
daf-12(ot870[daf-12::GFP::3xFlag]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050814 | Caenorhabditis elegans | daf-12(ot870[daf-12::GFP::3xFlag]) X. | Superficially wildtype. GFP tag inserted into endogenous daf-12 locus through CRISPR/Cas9 engineering. Reference: Aghayeva et al., submitted | WBGene00000908(daf-12) | WBGene00000908(daf-12) | WB-STRAIN:WBStrain00050814 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:26 | 0 | ||||
|
daf-16(ot853[daf-16::mNG::3xFlag::AID]) I; ieSi57 II; daf-2(e1370) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050816 | Caenorhabditis elegans | daf-16(ot853[daf-16::mNG::3xFlag::AID]) I; ieSi57 II; daf-2(e1370) III. | ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted | WBGene00000898(daf-2)|WBGene00000912(daf-16) | WBGene00000898(daf-2), WBGene00000912(daf-16) | WB-STRAIN:WBStrain00050816 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:26 | 0 | ||||
|
tbx-11(luc144) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050763 | Caenorhabditis elegans | tbx-11(luc144) III. | Made_by: Josef Rhsner|"Wild-type morphology. CRISPR/Cas9 engineered 1.3 kb deletion of the tbx-11 locus. Flanking sequence: aaaaataacaaaataacaaggaatgagaagggaaaacaggaaaaatacac / ttgccacgtgttgggcgggaaaacgcgtagtcatccggcaggtgtaacct Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421" | WBGene00006547(tbx-11) | WBGene00006547(tbx-11) | WB-STRAIN:WBStrain00050763 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:25 | 0 | ||||
|
drsh-1(luc82[myc::AID::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID::myc]) pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV; lucIs20; lucIs24. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050761 | Caenorhabditis elegans | drsh-1(luc82[myc::AID::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID::myc]) pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV; lucIs20; lucIs24. | ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Endogenous pash-1 tagged with the AID peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.|"Made_by: Philipp Dexheimer" | WBGene00006843(unc-119)|WBGene00009163(drsh-1)|WBGene00011908(pash-1) | WBGene00006843(unc-119), WBGene00009163(drsh-1), WBGene00011908(pash-1) | WB-STRAIN:WBStrain00050761 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||
|
wdIs132; uIs152. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050767 | Caenorhabditis elegans | wdIs132; uIs152. | Made_by: Seth Taylor in the Miller Lab|"wdIs132 [gcy-35::GFP]. uIs152 [mec-3::RFP]. AVM neurons are labeled with GFP and RFP. Can be used to isolate AVM by FACS. wdIs132 arose from spontaneous integration of kyEx1162 [gcy-35::GFP]. Used by CeNGEN project for RNA-Seq (https:" | WB-STRAIN:WBStrain00050767 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||||
|
jsTi1492 II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050800 | Caenorhabditis elegans | jsTi1492 II. | jsTi1492 [LoxP::mex-5p::FLP::SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] II. jsTi1492 is prone to silencing; pick animals with GFP+ germlines to maintain. jsTi1492 is an RMCE landing site inserted using miniMos located on Chr II at at 3,160,571 (WB273 genome; -8.14 m.u.) inserted in a repeat region between sri-34 and fbxc-55. Insertsion site ttttttgcaaaaaagtgcagtcataTAtgtatgtaaaaaattaattgaagac with rpl-28 transcription toward sri-34. Insertion site is ambiguous but likely near the edge of sri-34 side of the repeat region. Reference: Nonet ML. Genetics. 2020. | WB-STRAIN:WBStrain00050800 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||||
|
che-1(luc174) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050765 | Caenorhabditis elegans | che-1(luc174) I. | Made_by: Julien Charest|"Wild-type morphology. CRISPR/Cas9 engineered 3.38 kB deletion of the che-1 locus. Flank: caaaaacatcacaaaaataa" | WBGene00000483(che-1) | WBGene00000483(che-1) | WB-STRAIN:WBStrain00050765 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:25 | 0 | ||||
|
ynIs37 III; ufIs26. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050768 | Caenorhabditis elegans | ynIs37 III; ufIs26. | Made_by: John Tipps in the Miller Lab|"ynIs37 [flp-13p::GFP] III. ufIs26 [unc-4p::mCherry + lin-15(+)]. I5 neurons are labeled with GFP and RFP. Can be used to isolate I5 by FACS. Used by CeNGEN project for RNA-Seq (https:" | WB-STRAIN:WBStrain00050768 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:25 | 0 | ||||||
|
jsTi1453 jsSi1527 I; jsTi1493 jsSi1549 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050801 | Caenorhabditis elegans | jsTi1453 jsSi1527 I; jsTi1493 jsSi1549 IV. | jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1527 [LoxP::lexO 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1549 [LoxP::mec-4p::lexA-L-QF::FRT-3] IV. RMCE derived single copy lexO GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p lexA-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020. | WB-STRAIN:WBStrain00050801 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:26 | 0 | ||||||
|
lucEx755. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00050751 | Caenorhabditis elegans | lucEx755. | lucEx755 [tbx-32::GFP(fosmid) + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Wild-type morphology. Extrachromosomal TBX-32 direct fusion fosmid-based reporter. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421|"Made_by: Julien Charest" | WB-STRAIN:WBStrain00050751 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:25 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the ASWG Community.
Our Information
