Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search
Reset search
On page 95 showing 1881 ~ 1900 out of 64,152 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00050823

Source Database: WormBase (WB)
Affected Genes: WBGene00000903(daf-7)|WBGene00000908(daf-12)
Genomic Alteration: WBGene00000903(daf-7), WBGene00000908(daf-12)
Availability: unknown
Source References: EMPTY
Synonyms: daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP::AID]) X.
Notes: Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID conditional daf-12 allele in daf-7(e1372) background (TIR1-less control). Reference: Aghayeva et al., submitted

Proper citation: RRID:WB-STRAIN:WBStrain00050823 Copy   

http://www.wormbase.org/db/get?name=WBStrain00050829

Source Database: WormBase (WB)
Affected Genes: WBGene00004010(pha-1)
Genomic Alteration: WBGene00004010(pha-1)
Availability: unknown
Source References: EMPTY
Synonyms: pha-1(e2123) III; otEx7092.
Notes: otEx7092 [inx-18b(fosmid WRM0629cH03)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.

Proper citation: RRID:WB-STRAIN:WBStrain00050829 Copy   

http://www.wormbase.org/db/get?name=WBStrain00050827

Source Database: WormBase (WB)
Affected Genes: WBGene00004010(pha-1)
Genomic Alteration: WBGene00004010(pha-1)
Availability: unknown
Source References: EMPTY
Synonyms: pha-1(e2123) III; otEx7075.
Notes: otEx7075 [inx-18a(fosmid WRM0629cH03)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.

Proper citation: RRID:WB-STRAIN:WBStrain00050827 Copy   

http://www.wormbase.org/db/get?name=WBStrain00050770

Source Database: WormBase (WB)
Affected Genes: WBGene00000527(cle-1)
Genomic Alteration: WBGene00000527(cle-1)
Availability: unknown
Source References: EMPTY
Synonyms: cle-1(qy22[cle-1::mNG+loxP]) I.
Notes: Made_by: Qiuyi Chi, Daniel Keeley,Eric Hastie, Ranjay Jayad|"Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing."

Proper citation: RRID:WB-STRAIN:WBStrain00050770 Copy   

http://www.wormbase.org/db/get?name=WBStrain00050774

Source Database: WormBase (WB)
Affected Genes: WBGene00004749(sdn-1)
Genomic Alteration: WBGene00004749(sdn-1)
Availability: unknown
Source References: PMID:37039075, PMID:38964319
Synonyms: sdn-1(qy29[sdn-1::mNG+loxP]) X.
Notes: Made_by: Qiuyi Chi, Daniel Keeley,Eric Hastie, Ranjay Jayad|"SDN-1::mNG endogenous tag"|"Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing."

Proper citation: RRID:WB-STRAIN:WBStrain00050774 Copy   

http://www.wormbase.org/db/get?name=WBStrain00050771

Source Database: WormBase (WB)
Affected Genes: WBGene00001263(emb-9)
Genomic Alteration: WBGene00001263(emb-9)
Availability: unknown
Source References: PMID:38964319
Synonyms: emb-9(qy24[emb-9::mNG+loxP]) III.
Notes: Made_by: Qiuyi Chi, Daniel Keeley,Eric Hastie, Ranjay Jayad|"Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing."

Proper citation: RRID:WB-STRAIN:WBStrain00050771 Copy   

http://www.wormbase.org/db/get?name=WBStrain00050777

Source Database: WormBase (WB)
Affected Genes: WBGene00003242(mig-6)
Genomic Alteration: WBGene00003242(mig-6)
Availability: unknown
Source References: PMID:38964319
Synonyms: mig-6(qy37[mNG+loxP::mig-6]) V.
Notes: Made_by: Qiuyi Chi, Daniel Keeley,Eric Hastie, Ranjay Jayad|"Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. mNeonGreen is inserted at the N-terminus right before a putative proprotein convertase cleavage site and Western analysis indicates most of the mNeonGreen is cut from the MIG-1 protein and is diffuse in the extracellular fluid. See Figure S1 in Keeley et al., Dev Cell. 2020 Jul 6;54(1):60-74.e7. doi: 10.1016/j.devcel.2020.05.022. PMID: 32585132"

Proper citation: RRID:WB-STRAIN:WBStrain00050777 Copy   

http://www.wormbase.org/db/get?name=WBStrain00050810

Source Database: WormBase (WB)
Affected Genes: WBGene00002128(inx-6)
Genomic Alteration: WBGene00002128(inx-6)
Availability: unknown
Source References: EMPTY
Synonyms: inx-6(ot804 [inx-6::SL2::NLS::yfp::H2B]) IV.
Notes: inx-6(ot804) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-6 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.

Proper citation: RRID:WB-STRAIN:WBStrain00050810 Copy   

http://www.wormbase.org/db/get?name=WBStrain00050775

Source Database: WormBase (WB)
Affected Genes: WBGene00001863(him-4)
Genomic Alteration: WBGene00001863(him-4)
Availability: unknown
Source References: PMID:38964319
Synonyms: him-4(qy33[him-4::mNG+loxP]) X.
Notes: Made_by: Qiuyi Chi, Daniel Keeley,Eric Hastie, Ranjay Jayad|"Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing."

Proper citation: RRID:WB-STRAIN:WBStrain00050775 Copy   

http://www.wormbase.org/db/get?name=WBStrain00050815

Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00000912(daf-16)
Genomic Alteration: WBGene00000898(daf-2), WBGene00000912(daf-16)
Availability: unknown
Source References: EMPTY
Synonyms: daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; daf-2(e1370) III.
Notes: Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background (TIR1-less control). Reference: Aghayeva et al., submitted

Proper citation: RRID:WB-STRAIN:WBStrain00050815 Copy   

http://www.wormbase.org/db/get?name=WBStrain00050814

Source Database: WormBase (WB)
Affected Genes: WBGene00000908(daf-12)
Genomic Alteration: WBGene00000908(daf-12)
Availability: unknown
Source References: EMPTY
Synonyms: daf-12(ot870[daf-12::GFP::3xFlag]) X.
Notes: Superficially wildtype. GFP tag inserted into endogenous daf-12 locus through CRISPR/Cas9 engineering. Reference: Aghayeva et al., submitted

Proper citation: RRID:WB-STRAIN:WBStrain00050814 Copy   

http://www.wormbase.org/db/get?name=WBStrain00050816

Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00000912(daf-16)
Genomic Alteration: WBGene00000898(daf-2), WBGene00000912(daf-16)
Availability: unknown
Source References: EMPTY
Synonyms: daf-16(ot853[daf-16::mNG::3xFlag::AID]) I; ieSi57 II; daf-2(e1370) III.
Notes: ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted

Proper citation: RRID:WB-STRAIN:WBStrain00050816 Copy   

    • RRID:WB-STRAIN:WBStrain00050763

http://www.wormbase.org/db/get?name=WBStrain00050763

Source Database: WormBase (WB)
Affected Genes: WBGene00006547(tbx-11)
Genomic Alteration: WBGene00006547(tbx-11)
Availability: unknown
Source References: EMPTY
Synonyms: tbx-11(luc144) III.
Notes: Made_by: Josef Rhsner|"Wild-type morphology. CRISPR/Cas9 engineered 1.3 kb deletion of the tbx-11 locus. Flanking sequence: aaaaataacaaaataacaaggaatgagaagggaaaacaggaaaaatacac / ttgccacgtgttgggcgggaaaacgcgtagtcatccggcaggtgtaacct Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421"

Proper citation: RRID:WB-STRAIN:WBStrain00050763 Copy   

http://www.wormbase.org/db/get?name=WBStrain00050761

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00009163(drsh-1)|WBGene00011908(pash-1)
Genomic Alteration: WBGene00006843(unc-119), WBGene00009163(drsh-1), WBGene00011908(pash-1)
Availability: unknown
Source References: EMPTY
Synonyms: drsh-1(luc82[myc::AID::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID::myc]) pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV; lucIs20; lucIs24.
Notes: ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Endogenous pash-1 tagged with the AID peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.|"Made_by: Philipp Dexheimer"

Proper citation: RRID:WB-STRAIN:WBStrain00050761 Copy   

    • RRID:WB-STRAIN:WBStrain00050767

http://www.wormbase.org/db/get?name=WBStrain00050767

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: wdIs132; uIs152.
Notes: Made_by: Seth Taylor in the Miller Lab|"wdIs132 [gcy-35::GFP]. uIs152 [mec-3::RFP]. AVM neurons are labeled with GFP and RFP. Can be used to isolate AVM by FACS. wdIs132 arose from spontaneous integration of kyEx1162 [gcy-35::GFP]. Used by CeNGEN project for RNA-Seq (https:"

Proper citation: RRID:WB-STRAIN:WBStrain00050767 Copy   

    • RRID:WB-STRAIN:WBStrain00050800

http://www.wormbase.org/db/get?name=WBStrain00050800

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: jsTi1492 II.
Notes: jsTi1492 [LoxP::mex-5p::FLP::SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] II. jsTi1492 is prone to silencing; pick animals with GFP+ germlines to maintain. jsTi1492 is an RMCE landing site inserted using miniMos located on Chr II at at 3,160,571 (WB273 genome; -8.14 m.u.) inserted in a repeat region between sri-34 and fbxc-55. Insertsion site ttttttgcaaaaaagtgcagtcataTAtgtatgtaaaaaattaattgaagac with rpl-28 transcription toward sri-34. Insertion site is ambiguous but likely near the edge of sri-34 side of the repeat region. Reference: Nonet ML. Genetics. 2020.

Proper citation: RRID:WB-STRAIN:WBStrain00050800 Copy   

    • RRID:WB-STRAIN:WBStrain00050765

http://www.wormbase.org/db/get?name=WBStrain00050765

Source Database: WormBase (WB)
Affected Genes: WBGene00000483(che-1)
Genomic Alteration: WBGene00000483(che-1)
Availability: unknown
Source References: EMPTY
Synonyms: che-1(luc174) I.
Notes: Made_by: Julien Charest|"Wild-type morphology. CRISPR/Cas9 engineered 3.38 kB deletion of the che-1 locus. Flank: caaaaacatcacaaaaataa"

Proper citation: RRID:WB-STRAIN:WBStrain00050765 Copy   

    • RRID:WB-STRAIN:WBStrain00050768

http://www.wormbase.org/db/get?name=WBStrain00050768

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: ynIs37 III; ufIs26.
Notes: Made_by: John Tipps in the Miller Lab|"ynIs37 [flp-13p::GFP] III. ufIs26 [unc-4p::mCherry + lin-15(+)]. I5 neurons are labeled with GFP and RFP. Can be used to isolate I5 by FACS. Used by CeNGEN project for RNA-Seq (https:"

Proper citation: RRID:WB-STRAIN:WBStrain00050768 Copy   

http://www.wormbase.org/db/get?name=WBStrain00050801

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: jsTi1453 jsSi1527 I; jsTi1493 jsSi1549 IV.
Notes: jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1527 [LoxP::lexO 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1549 [LoxP::mec-4p::lexA-L-QF::FRT-3] IV. RMCE derived single copy lexO GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p lexA-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

Proper citation: RRID:WB-STRAIN:WBStrain00050801 Copy   

    • RRID:WB-STRAIN:WBStrain00050751

http://www.wormbase.org/db/get?name=WBStrain00050751

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: lucEx755.
Notes: lucEx755 [tbx-32::GFP(fosmid) + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Wild-type morphology. Extrachromosomal TBX-32 direct fusion fosmid-based reporter. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421|"Made_by: Julien Charest"

Proper citation: RRID:WB-STRAIN:WBStrain00050751 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. ScreenIT Resources

    Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within ASWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the ASWG Community.

Recent News Entries

Is the future of peer review automated?

Automated screening of COVID-19 preprints: can we help authors to improve transparency and reproducibility?

rTransparent

Contact Us

Our Information

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch