Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC2360 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00037284 | Caenorhabditis elegans | ucr-2.3(ok3073) III. | Made_by: Vancouver KO Group|"T24C4.1. External left primer: CGTGCTGGTTCTCGTTATGA. External right primer: CATATGCAGAGATGGCGAGA. Internal left primer: TCACTCAGCCTGGACTTGTG. Internal right primer: TTCTGGACCGTTGTAGAGGG. Internal WT amplicon: 1135 bp. Deletion size: 415 bp. Deletion left flank: GAATTGTGTTTGAGGATATTCATCGCGCTG. Deletion right flank: CTTCTCCACTGAAATTTGCATCACTTCCAG. Insertion Sequence: TTCA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00020757(ucr-2.3) | WBGene00020757(ucr-2.3) | WB-STRAIN:WBStrain00037284 | WormBase (WB) | WB | available | WB-STRAIN:VC2360, CGC_VC2360 | 2026-08-01 10:20:05 | 1 | |||
|
VC2310 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037246 | Caenorhabditis elegans | Y97E10AR.2(ok3098) V. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y97E10AR.2. External left primer: TTGCCGTTCACAGTATCCAA. External right primer: ACGTCGAACTGATCCCCATA. Internal left primer: GAAACTGGTGGAAACGCTGT. Internal right primer: GAACGCTTACGAATAGAAGAGCA. Internal WT amplicon: 1332 bp. Deletion size: 716 bp. Deletion left flank: CATCCGCACACTACAGGACCGGGTTTTGGA. Deletion right flank: ATCATTTCCATCAAACCCAGAATATATTTT." | WBGene00022397(Y97E10AR.2) | WBGene00022397(Y97E10AR.2) | WB-STRAIN:WBStrain00037246 | WormBase (WB) | WB | available | WB-STRAIN:VC2310, CGC_VC2310 | 2026-08-01 10:20:03 | 0 | |||
|
VC2308 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037244 | Caenorhabditis elegans | stc-1(ok2829)/mIn1 [mIs14 dpy-10(e128)] II. | F54C9.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2829 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAACCGCCAACGAGTACAAT. External right primer: CAACGGGATCATTGCTAGGT. Internal left primer: GCTAAAGCTGCCGTAATTGG. Internal right primer: TGGATTACCTCCACCACCTC. Internal WT amplicon: 1183 bp. Deletion size: 642 bp. Deletion left flank: TGCTTGAGTTACAAAAACTCCTCCTTGAAG. Deletion right flank: TCATTAAAACTTACAAGAAAGCAACGACAC. Insertion Sequence: TTAAAAC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00006059(stc-1) | WBGene00001072(dpy-10), WBGene00006059(stc-1) | WB-STRAIN:WBStrain00037244 | WormBase (WB) | WB | available | WB-STRAIN:VC2308, CGC_VC2308 | 2026-08-01 10:20:04 | 0 | |||
|
VC2309 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037245 | Caenorhabditis elegans | ZK669.4(ok3001) II. | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK669.4. Strain might be sensitive to hypochlorite; no survivors after mutliple attempts to clean by hypochlorite treatment. External left primer: TAGAGTGTTGAAAACGGGGG. External right primer: CCACACCAGCAGTTCGTAGA. Internal left primer: CATCAAGGGATAATTGGGCA. Internal right primer: GGAACTGGAAAAGACGGAAG. Internal WT amplicon: 1181 bp. Deletion size: 401 bp. Deletion left flank: TGTCATGTTTATCGAATCGTGGGAGTTTTT. Deletion right flank: CATTTTCCATTTTCTCATCAGTTGTAGAAT. Insertion Sequence: T." | WBGene00014054(dbt-1) | WBGene00014054(dbt-1) | WB-STRAIN:WBStrain00037245 | WormBase (WB) | WB | available | WB-STRAIN:VC2309, CGC_VC2309 | 2026-08-01 10:20:04 | 0 | |||
|
VC2317 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037250 | Caenorhabditis elegans | nhr-235(gk1085) II. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y38E10A.19. External left primer: TTTTTCATTTTGTGTGGCGA. External right primer: AATTCTGTGGAACTCGGTGG. Internal left primer: TGCTTGGTAGCTTTGCTTCA. Internal right primer: GAGTCGTGGAGTCTTGGCAT. Internal WT amplicon: 1867 bp. Deletion size: 935 bp. Deletion left flank: ACTCAAAGCTTACGTTGGAAATTATGTCGG. Deletion right flank: CCGAAAATTTTCAAAAAATTTTAGGATCTA. Insertion Sequence: AAATTTTCCGAAAATTT." | WBGene00012597(nhr-235) | WBGene00012597(nhr-235) | WB-STRAIN:WBStrain00037250 | WormBase (WB) | WB | available | WB-STRAIN:VC2317, CGC_VC2317 | 2026-08-01 10:20:04 | 0 | |||
|
VC2323 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037254 | Caenorhabditis elegans | dct-13(gk992) IV. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y116A8C.17. External left primer: AGCGAGCATTGCAAAAAGAT. External right primer: TATGAATGTCCGTGCTCTGC. Internal left primer: AAGAGCTGAGCAATGCCAAT. Internal right primer: ACAGCGTTTGTTCCGTATCC. Internal WT amplicon: 785 bp. Deletion size: 94 bp. Deletion left flank: AATTGACACCTGGCTCCGTACTTGCAATAT. Deletion right flank: ATTTGCATGCTTCACCGTAAATGCATGTTT." | WBGene00013794(dct-13) | WBGene00013794(dct-13) | WB-STRAIN:WBStrain00037254 | WormBase (WB) | WB | available | WB-STRAIN:VC2323, CGC_VC2323 | 2026-08-01 10:20:04 | 0 | |||
|
VC2320 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037251 | Caenorhabditis elegans | max-2(ok2553)/mnC1 [dpy-10(e128) unc-52(e444)] II. | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y38F1A.10. Apparent homozygous lethal deletion chromosome balanced by recombination suppressor marked with dpy-10 and unc-52. Heterozygotes are WT and segregate WT, paralyzed Dpy mnC1 homozygotes and ok2553 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGACAGAAATCGACAGCAGG. External right primer: ACGGGAACCCCCATATACTC. Internal left primer: AAGCGGTAAATGACGGAATG. Internal right primer: TGTGTCTGTGTGTCTTCGCA. Internal WT amplicon: 3342 bp. Deletion size: approximately 2000 bp." | WBGene00001072(dpy-10)|WBGene00003144(max-2)|WBGene00006787(unc-52) | WBGene00001072(dpy-10), WBGene00003144(max-2), WBGene00006787(unc-52) | WB-STRAIN:WBStrain00037251 | WormBase (WB) | WB | available | WB-STRAIN:VC2320, CGC_VC2320 | 2026-08-01 10:20:04 | 0 | |||
|
VC2321 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037252 | Caenorhabditis elegans | gcy-18(ok3047) IV/nT1 [qIs51] (IV;V). | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK896.8. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3047 homozygotes (sterile, lays eggs that don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATCGCTAATCCACTGGAACG. External right primer: CGATCCTCCAACCAGAATGT. Internal left primer: CTGCAAAAGATTCGGACGAT. Internal right primer: GTGCCCTTTCCTTTCACTTG. Internal WT amplicon: 1263 bp. Deletion size: 517 bp. Deletion left flank: TTTCAGCAATAATCTATATGGCTCCTGAAC. Deletion right flank: GAATGTTAGAAGAAGCCAACATCCGTGCTG." | WBGene00001543(gcy-18) | WBGene00001543(gcy-18) | WB-STRAIN:WBStrain00037252 | WormBase (WB) | WB | available | PMID:21173231 | WB-STRAIN:VC2321, CGC_VC2321 | 2026-08-01 10:20:04 | 0 | ||
|
VC2326 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037257 | Caenorhabditis elegans | C06E1.8(gk1061) III. | C06E1.8. External left primer: CCCGCAAACAGGAAGAAATA. External right primer: CTGCTGCTCCAAAACATTGA. Internal left primer: GCACAGTTTGTTCCAATCCA. Internal right primer: TTCTTCTTCCTCCTCCGTCA. Internal WT amplicon: 2185 bp. Deletion size: 559 bp. Deletion left flank: ATTATTCAAAGTCCCCAATTCAAATACAGT. Deletion right flank: GTTTTCATTCTATTTCATATTTTTGTCTCC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00061672 paper added based on AFP_Strain data." | WBGene00015523(ztf-30) | WBGene00015523(ztf-30) | WB-STRAIN:WBStrain00037257 | WormBase (WB) | WB | available | PMID:34271120 | WB-STRAIN:VC2326, CGC_VC2326 | 2026-08-01 10:20:04 | 0 | ||
|
VC2324 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00037255 | Caenorhabditis elegans | flp-6(ok3056)ZK6.11(ok3738) | F07D3.2. External left primer: ACTCCCCCTCATCCAAATTC. External right primer: TTTCGCGAATGAAGCTATGA. Internal left primer: CCCCACGTTACCAGATGATATT. Internal right primer: CCAGTTGGTCCTTACAAGAGC. Internal WT amplicon: 1129 bp. Deletion size: 421 bp. Deletion left flank: TATGTTTTTCTGTTCAACGTTTTTTATTTA. Deletion right flank: GTGGAAACCCAATGGAAATGGAAAAACGGA. Insertion Sequence: A.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001449(flp-6) | WBGene00001449(flp-6) | WB-STRAIN:WBStrain00037255 | WormBase (WB) | WB | available | PMID:38443452 | WB-STRAIN:VC2324, CGC_VC2324 | 2026-08-01 10:20:04 | 4 | ||
|
VC2330 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037260 | Caenorhabditis elegans | Y39A1C.1(ok3032) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y39A1C.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3032 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCGTGGTGACTCCAAAACTT. External right primer: CTGCGTCTCCTCCTCTTCAC. Internal left primer: TTGGGTTTCCATGGTGACTT. Internal right primer: AAAAACCCGCATCTAACCAC. Internal WT amplicon: 1253 bp. Deletion size: 520 bp. Deletion left flank: CGAACCGTGGTGTCTCCAGGCGGGAATTCA. Deletion right flank: TTTTTGTAAATAAATTGAATTTTTAATATG. Insertion Sequence: TT." | WBGene00000254(bli-4)|WBGene00012662(tmie-1) | WBGene00000254(bli-4), WBGene00012662(tmie-1) | WB-STRAIN:WBStrain00037260 | WormBase (WB) | WB | available | WB-STRAIN:VC2330, CGC_VC2330 | 2026-08-01 10:20:04 | 0 | |||
|
VC2332 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037261 | Caenorhabditis elegans | pat-2(ok2148) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | F54F2.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2148 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTCATCGTCTTGGATACG. External right primer: AAGTGAAGTTTGTCAGCCCG. Internal left primer: TCGTGTTTTTATTGGAGCCC. Internal right primer: CGACTATGAGATCGTGGCAA. Internal WT amplicon: 3238 bp. Deletion size: 1660 bp. Deletion left flank: CAGTTGTTGGAGATGATCAGTGGGGACGAT. Deletion right flank: TTTTATAATGAGACAAGTTCACAGCCATTT. Insertion Sequence: GTGGAGTGGAGAGATGTGGAGTGGGGAGTGGGGAGTGGGGA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00003929(pat-2) | WBGene00000254(bli-4), WBGene00003929(pat-2) | WB-STRAIN:WBStrain00037261 | WormBase (WB) | WB | available | WB-STRAIN:VC2332, CGC_VC2332 | 2026-08-01 10:20:04 | 0 | |||
|
VC2336 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037264 | Caenorhabditis elegans | Y52B11A.9(gk1120) I. | Made_by: Vancouver KO Group|"This strain is homozygous for a deletion (gk1120) in Y52B11A.9, detectable by PCR using the following primers. External left primer: CAATCCCCTCTCTCATCCAA. External right primer: TATTTGCAACGACACTCCGA. Internal left primer: TGCATATGACGCTCTTCGTC. Internal right primer: TTCCAGCTTCTGCCAAATGT. Internal WT amplicon: 1563 bp. Deletion size: 405 bp. Deletion left flank: GGAGCTTTTCGGCTCAAATTATTGGAATAT. Deletion right flank: ACAAACTACAAAATTTCTAGCCTCTACCAA. Validation: gk1120 passed by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00013128(dxbp-1) | WBGene00013128(dxbp-1) | WB-STRAIN:WBStrain00037264 | WormBase (WB) | WB | available | WB-STRAIN:VC2336, CGC_VC2336 | 2026-08-01 10:20:04 | 0 | |||
|
VC2337 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037265 | Caenorhabditis elegans | Y116A8C.4(ok3077) IV. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y116A8C.4. External left primer: CGACGTTGTTTCCAGGATTT. External right primer: TTCCACCCAACTCACATTCA. Internal left primer: GCGCTGAGCTCTCAAAGACT. Internal right primer: GACAAGCCCCATAAAGTCCA. Internal WT amplicon: 1215 bp. Deletion size: 526 bp. Deletion left flank: TGTATCACGCTTGCTCATCAATTGGTAGGA. Deletion right flank: TTTCTTCAAATAGTTATTTTAGAAATGCTC. Insertion Sequence: TCGACATCTTCCGGGTTTCCAGACCCATAAAATGTCGGTTGCTAGATAATAAATCAA." | WBGene00013785(nep-23) | WBGene00013785(nep-23) | WB-STRAIN:WBStrain00037265 | WormBase (WB) | WB | available | WB-STRAIN:VC2337, CGC_VC2337 | 2026-08-01 10:20:05 | 0 | |||
|
VC2461 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037345 | Caenorhabditis elegans | Y22D7AL.7(gk3210) III; R11E3.2(gk3211) ZK616.3(gk3212) IV; F39F10.2(gk1161) X. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1161) in F39F10.2, detectable by PCR using the following primers. External left primer: GTGCTCACCGAGATGTCTGA. External right primer: GCTGATTTCGCTCAACACAA. Internal left primer: GACCCGGTAATTGAGCAGAA. Internal right primer: TGCGAACATTCGTTGAGTTC. Internal WT amplicon: 2489 bp. Deletion size: 500 bp. Deletion left flank: TTCAATTAGGATGTCGTAAACGCAGTGGCT. Deletion right flank: GTGATATCCTAAAAATTATGTTTAAGTTAT. Validation: gk1161 passed by CGH. Other deletions (gk3210, gk3211, gk3212) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00018202(F39F10.2)|WBGene00020004(R11E3.2)|WBGene00021246(Y22D7AL.7)|WBGene00022773(ZK616.3) | WBGene00018202(F39F10.2), WBGene00020004(R11E3.2), WBGene00021246(Y22D7AL.7), WBGene00022773(ZK616.3) | WB-STRAIN:WBStrain00037345 | WormBase (WB) | WB | available | WB-STRAIN:VC2461, CGC_VC2461 | 2026-08-01 10:20:05 | 0 | |||
|
VC2476 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037352 | Caenorhabditis elegans | Y43D4A.6(gk1142) IV. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y43D4A.6. Identified by PCR, validated by CGH. External left primer: ACGATAAACCAGCAGACGCT. External right primer: TTTGAAAACGGTGTGAAACG. Internal left primer: AACTGTGTTCGAAACCCTCG. Internal right primer: TCAAGCTCATTCGGATTTCA. Internal WT amplicon: 2337 bp. Deletion size: 1390 bp. Deletion left flank: CAAGTTTATCAACAACGTGAAACAGACAAT. Deletion right flank: CAGCAAAAAAATCACTTGCTCCAGTAATTC." | WBGene00012792(Y43D4A.6) | WBGene00012792(Y43D4A.6) | WB-STRAIN:WBStrain00037352 | WormBase (WB) | WB | available | WB-STRAIN:VC2476, CGC_VC2476 | 2026-08-01 10:20:05 | 0 | |||
|
VC2477 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00037353 | Caenorhabditis elegans | T24B8.5(ok3236) II. | Made_by: Vancouver KO Group|"T24B8.5. External left primer: CCGTCTCTCTCCGTTTTGTT. External right primer: CTACATCCGGCTGCCTATTC. Internal left primer: CTTTTCCGTCCGTTCGATT. Internal right primer: CCCTTGAATGCTTCTGGTTT. Internal WT amplicon: 1299 bp. Deletion size: 509 bp. Deletion left flank: TTTGGGCATTGTCTGAAATTTCAGATGAGA. Deletion right flank: GGTAAAGTTTAGAACAATTGAAGTGACAAA. Insertion Sequence: CTATAAAAACTACGTCAAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011979(sysm-1) | WBGene00011979(sysm-1) | WB-STRAIN:WBStrain00037353 | WormBase (WB) | WB | available | PMID:32560629 | WB-STRAIN:VC2477, CGC_VC2477 | 2026-08-01 10:20:06 | 1 | ||
|
VC2474 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037350 | Caenorhabditis elegans | nhr-178(gk1158) V. | F16B4.9. Identified by PCR, validated by CGH. External left primer: ACATCCATCTTTCTGGCGAC. External right primer: TTCGGAGTCACAAGTTGCAG. Internal left primer: GCGCACCCTGAACATAGTTT. Internal right primer: AAATATGGGAGCAGCGTTTG. Internal WT amplicon: 1511 bp. Deletion size: 502 bp. Deletion left flank: ATCTAAAATCGCGCTTTTGATTTTGTTCTG. Deletion right flank: ATATAAACGACTATATTTGCATTGAATTCA. Insertion Sequence: TAAACGACTATATTTGCATTGA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00017510(nhr-178) | WBGene00017510(nhr-178) | WB-STRAIN:WBStrain00037350 | WormBase (WB) | WB | available | WB-STRAIN:VC2474, CGC_VC2474 | 2026-08-01 10:20:06 | 0 | |||
|
VC2475 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037351 | Caenorhabditis elegans | M04C7.4(gk3034) I; F26A1.4(gk1160) III. | F26A1.4, M04C7.4. The allele gk1160 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTTAGGTCTGGCACTACCCG. External right primer: AAAACATTGACACACCTGCG. Internal left primer: AAAGCGGCAGCAGTTAAGAA. Internal right primer: CTACCGGTACTGCCATTCGT. Internal WT amplicon: 1327 bp. Deletion size: 126 bp. Deletion left flank: TCACGGATCGGACTCTTTACCGTGCAATGG. Deletion right flank: TTTTTTAAATTGAAAATGCGAGCATCTAGG. The allele gk3034 was identified by CGH but not confirmed by PCR. Left flanking probe: GTACGGTAAGTTGGCCGAGTTGCATTATTCGTCTCGTTCAAGAGGATAAC. Right flanking probe: CAGGCACGCAGGCGCATCTGCACGTACCATGGCTACTTTAGCTGATGAAC. Left deleted probe: GATTTTATCAGCATACGGGCTCGTAAAAGAGAAGAGGAGACGAGGTTACG. Right deleted probe: CTGTGGCTGCTGTTCCAAATGCCAATCTGGAAATGGGAATTTCGGTAACT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010855(M04C7.4)|WBGene00017803(F26A1.4) | WBGene00010855(M04C7.4), WBGene00017803(F26A1.4) | WB-STRAIN:WBStrain00037351 | WormBase (WB) | WB | available | WB-STRAIN:VC2475, CGC_VC2475 | 2026-08-01 10:20:05 | 0 | |||
|
VC2479 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037354 | Caenorhabditis elegans | +/mT1 II; F09F7.3(ok3162)/mT1 [dpy-10(e128)] III. | F09F7.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3162 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATACCCAACAGCAGGCACTC. External right primer: TTCGACAATTCCGTCATCAA. Internal left primer: TGTTACCTCAAAAGTCAAGGCT. Internal right primer: CGATTGGTTAGAGAACGGGA. Internal WT amplicon: 1204 bp. Deletion size: 794 bp. Deletion left flank: ACGTTTGGAGCTCGCTGGATCATTGCTTTC. Deletion right flank: TGGTGAAAGCCGTCAGAGATTTGAGAAGGT. Insertion Sequence: AT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00017300(rpc-2) | WBGene00001072(dpy-10), WBGene00017300(rpc-2) | WB-STRAIN:WBStrain00037354 | WormBase (WB) | WB | available | WB-STRAIN:VC2479, CGC_VC2479 | 2026-08-01 10:20:05 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the ASWG Community.
Our Information
