Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC293 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035654 | Caenorhabditis elegans | mep-1(ok421)/mIs11 IV. | omozygous sterile deletion chromosome balanced by pharyngeal GFP insertion. Heterozygotes are WT with semi-dominant GFP signal. Segregates WT dim GFP (heterozygotes), WT brighter GFP (mIs11 homozygotes) and non-GFP ok421 homozygotes (sterile adult often with vulval blip). Pick dim GFP WT and check for correct segregation of progeny to maintain. Reasonably well-balanced. | WBGene00003218(mep-1) | WBGene00003218(mep-1) | WB-STRAIN:WBStrain00035654 | WormBase (WB) | WB | unknown | WB-STRAIN:VC293 | 2026-07-25 10:24:01 | 0 | |||
|
RW11383 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033694 | Caenorhabditis elegans | unc-119(ed3) III; stIs11383. | Made_by: E Preston/J Murray|"stIs11383 [Y71G12B.6::H1-wCherry + unc-119(+)]." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00033694 | WormBase (WB) | WB | unknown | WB-STRAIN:RW11383 | 2026-07-25 10:23:31 | 0 | |||
|
RZB213 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033875 | Caenorhabditis elegans | plst-1(msn190[plst-1::gfp]) IV. | Reference WBPaper00056840 added based on published strain data identified by Textpresso literature search. | WBGene00022425(plst-1) | WBGene00022425(plst-1) | WB-STRAIN:WBStrain00033875 | WormBase (WB) | WB | unknown | PMID:28400443 PMID:31160462 |
WB-STRAIN:RZB213 | 2026-07-25 10:23:34 | 0 | ||
|
RZB217 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033876 | Caenorhabditis elegans | plst-1(msn190[plst-1::gfp]) IV; zbIs2(pie-1::lifeACT::RFP). | EMPTY | WBGene00022425(plst-1) | WBGene00022425(plst-1) | WB-STRAIN:WBStrain00033876 | WormBase (WB) | WB | unknown | PMID:28400443 | WB-STRAIN:RZB217 | 2026-07-25 10:23:34 | 3 | ||
|
SD1145 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033920 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00001790(gst-42) | WBGene00001790(gst-42) | WB-STRAIN:WBStrain00033920 | WormBase (WB) | WB | unknown | WB-STRAIN:SD1145 | 2026-07-25 10:23:34 | 0 | |||
|
SD1147 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033922 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00016097(C25E10.8) | WBGene00016097(C25E10.8) | WB-STRAIN:WBStrain00033922 | WormBase (WB) | WB | unknown | WB-STRAIN:SD1147 | 2026-07-25 10:23:34 | 0 | |||
|
SD1158 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033925 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00000412(cdr-1) | WBGene00000412(cdr-1) | WB-STRAIN:WBStrain00033925 | WormBase (WB) | WB | unknown | WB-STRAIN:SD1158 | 2026-07-25 10:23:34 | 0 | |||
|
SD1168 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033928 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00000615(col-38) | WBGene00000615(col-38) | WB-STRAIN:WBStrain00033928 | WormBase (WB) | WB | unknown | WB-STRAIN:SD1168 | 2026-07-25 10:23:34 | 0 | |||
|
SD1172 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033931 | Caenorhabditis elegans | pha-1(e2123) III; mvEx5506. | mvEx5506 [mtl-1p::GFP + pha-1(+)]. Maintain at 25C to select for presence of the array. | WBGene00003473(mtl-1)|WBGene00004010(pha-1) | WBGene00003473(mtl-1), WBGene00004010(pha-1) | WB-STRAIN:WBStrain00033931 | WormBase (WB) | WB | unknown | WB-STRAIN:SD1172 | 2026-07-25 10:23:34 | 0 | |||
|
SD1175 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033934 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00001789(gst-41) | WBGene00001789(gst-41) | WB-STRAIN:WBStrain00033934 | WormBase (WB) | WB | unknown | WB-STRAIN:SD1175 | 2026-07-25 10:23:34 | 0 | |||
|
SD1176 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033935 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00006207(str-162) | WBGene00006207(str-162) | WB-STRAIN:WBStrain00033935 | WormBase (WB) | WB | unknown | WB-STRAIN:SD1176 | 2026-07-25 10:23:34 | 0 | |||
|
SD1139 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033918 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00011244(R11D1.3) | WBGene00011244(R11D1.3) | WB-STRAIN:WBStrain00033918 | WormBase (WB) | WB | unknown | WB-STRAIN:SD1139 | 2026-07-25 10:23:34 | 0 | |||
|
SD1823 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034024 | Caenorhabditis elegans | unc-119(ed3) III; gaEx232. | gaEx207 [sod-3p::mCherry + aakg-2(sta2) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.|"gaEx232 [aakg-2(sta2)(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of activated AAKG-2. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034024 | WormBase (WB) | WB | unknown | WB-STRAIN:SD1823 | 2026-07-25 10:23:36 | 0 | |||
|
SM1535 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034114 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00003976(pes-1) | WBGene00003976(pes-1) | WB-STRAIN:WBStrain00034114 | WormBase (WB) | WB | unknown | WB-STRAIN:SM1535 | 2026-07-25 10:23:37 | 0 | |||
|
SOZ471 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034121 | Caenorhabditis elegans | sams-1(ssd206) X. | no longer available from the CGC|"sams-1 (a.k.a.- drop-4) Class IV supersized lipid droplet mutant. GCT-->GTT mutation. 5' flanking sequence: agatccaaatgcaaaggttg. 3' flanking sequence: ttgcgagaccgtaacaaaaa References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846." | WBGene00008205(sams-1) | WBGene00008205(sams-1) | WB-STRAIN:WBStrain00034121 | WormBase (WB) | WB | unknown | WB-STRAIN:SOZ471 | 2026-07-25 10:23:37 | 0 | |||
|
SM202 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034105 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00003937(pax-1) | WBGene00003937(pax-1) | WB-STRAIN:WBStrain00034105 | WormBase (WB) | WB | unknown | WB-STRAIN:SM202 | 2026-07-25 10:23:37 | 0 | |||
|
SP978 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034341 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00034341 | WormBase (WB) | WB | unknown | WB-STRAIN:SP978 | 2026-07-25 10:23:40 | 0 | |||||
|
ST205 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034492 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00034492 | WormBase (WB) | WB | unknown | WB-STRAIN:ST205 | 2026-07-25 10:23:43 | 0 | |||||
|
SS629 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034450 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00004027(pie-1) | WBGene00004027(pie-1) | WB-STRAIN:WBStrain00034450 | WormBase (WB) | WB | unknown | WB-STRAIN:SS629 | 2026-07-25 10:23:42 | 0 | |||
|
STR59 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034513 | Caenorhabditis elegans | cdk-5(ok626);hrtSi4[Pgcy-36::ebp-2::gfp] | EMPTY | WB-STRAIN:WBStrain00034513 | WormBase (WB) | WB | unknown | PMID:30254025 | WB-STRAIN:STR59 | 2026-07-25 10:23:43 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the ASWG Community.
Our Information
