Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00055735
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00017641(csr-1)
Genomic Alteration: WBGene00017641(csr-1)
Availability: unknown
References:
Synonyms: fjSi1 II; csr-1(fj54) IV.
Alternate IDs:
Notes: fjSi1 [2FLAG::csr-1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2FLAG::csr-1 transgene was designed to express proteins with a double FLAG tag instead of the N169 of CSR-1a and N6 of CSR-1b. The linker sequence between the two FLAG tags has a NotI site. The insertion can be checked by PCR with the following primers: CACACTCGATTCTACGCCAA (at the 3'-side of csr-1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
Proper citation: RRID:WB-STRAIN:WBStrain00055735 Copy
http://www.wormbase.org/db/get?name=WBStrain00055734
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006762(unc-25)
Genomic Alteration: WBGene00006762(unc-25)
Availability: unknown
References:
Synonyms: unc-25(e156) III; hpIs673; ljIs131.
Alternate IDs:
Notes: hpIs673 [rgef-1p::Chrimson::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. All neurons are marked with red fluorescence. Pan-neuronal activation and muscle contraction upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055734 Copy
http://www.wormbase.org/db/get?name=WBStrain00055685
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: hpIs740.
Alternate IDs:
Notes: hpIs740 [twk-40(s)p::GCaMP6s::wScarlet + lin-15(+)]. GCaMP and RFP expression in AVA, AVB, AVE and DVA. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055685 Copy
http://www.wormbase.org/db/get?name=WBStrain00055684
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: hpIs758.
Alternate IDs:
Notes: hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Weak myo-2 and AVA Cherry expression. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055684 Copy
http://www.wormbase.org/db/get?name=WBStrain00055687
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: hpIs717; ljIs131.
Alternate IDs:
Notes: hpIs717 [acr-2(s)p::LoxP::eBFP::LoxP::Chrimson::wCherry + unc-17p::Cre + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055687 Copy
http://www.wormbase.org/db/get?name=WBStrain00055686
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006762(unc-25)
Genomic Alteration: WBGene00006762(unc-25)
Availability: unknown
References:
Synonyms: unc-25(e156) III; ljIs131; hpIs758.
Alternate IDs:
Notes: ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Shrinker. RFP expression in AVA and a few other neurons. Reversal upon green light illumination with ATR. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055686 Copy
http://www.wormbase.org/db/get?name=WBStrain00055683
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006762(unc-25)
Genomic Alteration: WBGene00006762(unc-25)
Availability: unknown
References:
Synonyms: unc-25(e156) III; hpIs593; ljIs131.
Alternate IDs:
Notes: hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. D motor neurons are marked with red fluorescence. No behavioral change upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055683 Copy
http://www.wormbase.org/db/get?name=WBStrain00055726
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: hpIs625; ljIs131.
Alternate IDs:
Notes: hpIs625 [ttr-39p::Arch::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055726 Copy
http://www.wormbase.org/db/get?name=WBStrain00055725
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006762(unc-25)
Genomic Alteration: WBGene00006762(unc-25)
Availability: unknown
References:
Synonyms: unc-25(e156) III; ljIs131.
Alternate IDs:
Notes: ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055725 Copy
http://www.wormbase.org/db/get?name=WBStrain00055689
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: hpIs592; hpIs595.
Alternate IDs:
Notes: hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. hpIs595 [acr-2(s)p::GCaMP6s::wCherry + lin-15(+)]. Body relaxation upon green light illumination with ATR. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055689 Copy
http://www.wormbase.org/db/get?name=WBStrain00055688
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006691(twk-40)
Genomic Alteration: WBGene00006691(twk-40)
Availability: unknown
References:
Synonyms: twk-40(bln282[twk-40::TagRFP::ZF]) III; hpEx4120.
Alternate IDs:
Notes: hpEx4120 [rgef-1p::GPI::YFP]. Pick YFP+ animals to maintain. TagRFP::ZF tag inserted into endogenous twk-40 locus.
Proper citation: RRID:WB-STRAIN:WBStrain00055688 Copy
http://www.wormbase.org/db/get?name=WBStrain00055721
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006691(twk-40)
Genomic Alteration: WBGene00006691(twk-40)
Availability: unknown
References:
Synonyms: twk-40(hp834) III.
Alternate IDs:
Notes: Loss-of-function allele. Loopy movement with increased reversals.
Proper citation: RRID:WB-STRAIN:WBStrain00055721 Copy
http://www.wormbase.org/db/get?name=WBStrain00055723
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: hpIs371; hpIs365.
Alternate IDs:
Notes: hpIs371 [unc-4p::miniSOG::SL2::wCherry + lin-15(+)]. hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
Proper citation: RRID:WB-STRAIN:WBStrain00055723 Copy
http://www.wormbase.org/db/get?name=WBStrain00055729
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001457(flp-14)
Genomic Alteration: WBGene00001457(flp-14)
Availability: unknown
References:
Synonyms: flp-14(gk1055) III; hpSi38; hpIs201.
Alternate IDs:
Notes: hpSi38 [flp-14(+) + NeoR]. hpIs201[ceh-10p::GFP + lin-15(+)]. GFP expression in RID neuron. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant behavioral defects and RID axon defects. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782|"Made_by: Jun"
Proper citation: RRID:WB-STRAIN:WBStrain00055729 Copy
http://www.wormbase.org/db/get?name=WBStrain00055676
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006840(unc-116)
Genomic Alteration: WBGene00006840(unc-116)
Availability: unknown
References:
Synonyms: unc-116(rh24sb79) III; oyIs14 V.
Alternate IDs:
Notes: Made_by: Chen Ding|"oyIs14 [sra-6p::GFP + lin-15(+)]. Disrupted mitochondrial trafficking. sb79 is an intragenic suppressor of the rh24 gain-of-function allele. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800."
Proper citation: RRID:WB-STRAIN:WBStrain00055676 Copy
http://www.wormbase.org/db/get?name=WBStrain00055670
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: wpIs107 I.
Alternate IDs:
Notes: Made_by: Marc Hammarlund Lab|"wpIs107 [F49C12.10p::GFP] I. GFP expression in CAN neurons can be used to isolate CAN by FACS. F49C12.10 also known as nemt-1. Used by CeNGEN project for RNA-Seq (https:"|"wpIs107 [F49C12.10p::GFP] I. GFP expression in CAN neurons can be used to isolate CAN by FACS. Used by CeNGEN project for RNA-Seq (https:"
Proper citation: RRID:WB-STRAIN:WBStrain00055670 Copy
http://www.wormbase.org/db/get?name=WBStrain00055671
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006752(unc-13)|WBGene00010259(ric-7)
Genomic Alteration: WBGene00006752(unc-13), WBGene00010259(ric-7)
Availability: unknown
References:
Synonyms: wpIs98 unc-13(e51) I; ric-7(n2657) V.
Alternate IDs:
Notes: Made_by: Chen Ding|"wpIs98 [itr-1pB::Chrimson::SL2::mCherry + odr-1p::RFP] I. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829."
Proper citation: RRID:WB-STRAIN:WBStrain00055671 Copy
http://www.wormbase.org/db/get?name=WBStrain00055714
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006691(twk-40)
Genomic Alteration: WBGene00006691(twk-40)
Availability: unknown
References:
Synonyms: twk-40(bln336) III; hpEx4479.
Alternate IDs:
Notes: hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(bln336) is a gain-of-function allele. Paralyzed; no backward movement upon head touch. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with weaker expression than in a wild-type background.
Proper citation: RRID:WB-STRAIN:WBStrain00055714 Copy
http://www.wormbase.org/db/get?name=WBStrain00055716
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: hpIs636; hpEx4479.
Alternate IDs:
Notes: hpIs636 [rig-3p::HisCl1::SL2::mCherry]. hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. Synapse exocytosis marker in AVA. Transgenic animals exhibit punctate green fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background. mCherry and HisCl1 expression in AVA soma and neurites. In the presence of histamine, the SNB-1::pHluorin intensity will decrease in neurites.
Proper citation: RRID:WB-STRAIN:WBStrain00055716 Copy
http://www.wormbase.org/db/get?name=WBStrain00055678
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004010(pha-1)
Genomic Alteration: WBGene00004010(pha-1)
Availability: unknown
References:
Synonyms: pha-1(e2123) III; wpEx505.
Alternate IDs:
Notes: Made_by: Manasa Basavaraju (Hammarlund Lab)|"wpEx505 [ocr-3p::mEGFP + pha-1(+)]. Maintain at 23-25C to select for array. PVP neurons are marked with mEGFP. Can be used to isolate PVP by FACS. Used by CeNGEN project for RNA-Seq (https:"
Proper citation: RRID:WB-STRAIN:WBStrain00055678 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within ASWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the ASWG Community.
Our Information
