Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00037235

Source Database: WormBase (WB)
Affected Genes: WBGene00012302(dot-1.3)
Genomic Alteration: WBGene00012302(dot-1.3)
Availability: available
Source References: EMPTY
Synonyms: W06D11.4(ok2831) X.
Alternate IDs: WB-STRAIN:VC2294, CGC_VC2294
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"W06D11.4. External left primer: CGAAAAACAAAAAGGAGGCA. External right primer: GTTTCCAAACACGCTCCATT. Internal left primer: TATTGAGGAGGAGGGAAGGG. Internal right primer: TTTTCTGGACAAACGCTGAG. Internal WT amplicon: 1279 bp. Deletion size: 970 bp. Deletion left flank: TAGTCAAGTAGAATGGCACTTTTCTACTTG. Deletion right flank: GAACCTTCACGGCATCAAGAATCGGCTTGT."

Proper citation: RRID:WB-STRAIN:WBStrain00037235 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037233

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00006790(unc-55)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006790(unc-55)
Availability: available
Source References: EMPTY
Synonyms: unc-55(ok2822) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2292, CGC_VC2292
Notes: F55D12.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2822 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGACATGTCGGTTGGGATT. External right primer: GCCGAGAATGAGGAATTCAA. Internal left primer: GAGACGGGGGCATACTGTAG. Internal right primer: ACCACGTGGATTTTCATTCG. Internal WT amplicon: 1112 bp. Deletion size: 492 bp. Deletion left flank: ATCAAGGAGACGGGGGCATACTGTAGGTCA. Deletion right flank: AAACCTTATGTCAAAATTTTTTTTCTGGAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037233 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037234

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00015232(B0511.6)
Genomic Alteration: WBGene00000254(bli-4), WBGene00015232(B0511.6)
Availability: available
Source References: EMPTY
Synonyms: B0511.6(ok2948) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2293, CGC_VC2293
Notes: B0511.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1948 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTGTCTTTTCCCTTCTGG. External right primer: CGTTCATTTCCGGTCTTTGT. Internal left primer: TCATAAAATTTGTTAATTTTGCAGG. Internal right primer: CCAATGAACGAAACAACGTG. Internal WT amplicon: 1363 bp. Deletion size: 577 bp. Deletion left flank: TGGACGACTTTTGGATCATCTTCAGAATAC. Deletion right flank: ACAACTCGCGGAAATGTTTTTTATTTAATT.|"B0511.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2948 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTGTCTTTTCCCTTCTGG. External right primer: CGTTCATTTCCGGTCTTTGT. Internal left primer: TCATAAAATTTGTTAATTTTGCAGG. Internal right primer: CCAATGAACGAAACAACGTG. Internal WT amplicon: 1363 bp. Deletion size: 577 bp. Deletion left flank: TGGACGACTTTTGGATCATCTTCAGAATAC. Deletion right flank: ACAACTCGCGGAAATGTTTTTTATTTAATT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037234 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037239

Source Database: WormBase (WB)
Affected Genes: WBGene00004221(ptr-6)
Genomic Alteration: WBGene00004221(ptr-6)
Availability: available
Source References: EMPTY
Synonyms: ptr-6(ok2988) II.
Alternate IDs: WB-STRAIN:VC2301, CGC_VC2301
Notes: C54A12.1. External left primer: AAAATGATGTTCCTTTGCCG. External right primer: GCTCTTGTGGTTCGGAATGT. Internal left primer: CAAGAGCTGAAATTTTGAATAGGA. Internal right primer: ACACTCATCGCTCCGTTCTT. Internal WT amplicon: 1379 bp. Deletion size: 493 bp. Deletion left flank: TCTCTGAAATGATGGAAATGTAAAAAGGTA. Deletion right flank: CAAAGAAGGTGATTTGATAAAGGAATGTGA. Insertion Sequence: CAA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037239 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037238

Source Database: WormBase (WB)
Affected Genes: WBGene00008882(F16B12.6)
Genomic Alteration: WBGene00008882(F16B12.6)
Availability: available
Source References: EMPTY
Synonyms: F16B12.6(gk1118) X.
Alternate IDs: WB-STRAIN:VC2300, CGC_VC2300
Notes: F16B12.6. Identified by PCR, validated by CGH. External left primer: CGATCACCAACAAACAATGC. External right primer: TACGTGACCCGTTGACAAAA. Internal left primer: CAGTTTAGAAATGCCTCGCC. Internal right primer: CGGACCGTCGTAAACAAACT. Internal WT amplicon: 2674 bp. Deletion size: 2358 bp. Deletion left flank: ATTGTGAAAACAAAAAAAAACAGATGAAGC. Deletion right flank: GCAATTCTTCAATCATTTCAGGTTTTCTAT. Insertion Sequence: AGATGA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037238 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037243

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00010478(dkc-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00010478(dkc-1)
Availability: available
Source References: EMPTY
Synonyms: K01G5.5(ok2795) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2307, CGC_VC2307
Notes: K01G5.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2795 homozygotes (early larval arrest, Dpy or Dpyish). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAACTTCCATCCTCGAAC. External right primer: CCTCCTCCTCTTCCTCGTCT. Internal left primer: CGCACCAATCACTACACACC. Internal right primer: GGCGTCTCCTCTTTCTTGAC. Internal WT amplicon: 1149 bp. Deletion size: 997 bp. Deletion left flank: GGGAGTATCACCATTAAAGCGTGACATCAA. Deletion right flank: ATTCGGAAAACCAAATGACACTACTCCAAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037243 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037240

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: C52G5(gk1233) X.
Alternate IDs: WB-STRAIN:VC2302, CGC_VC2302
Notes: C52G5. Identified by PCR, validated by CGH. External left primer: TCTTGGCTTTCTGACGTGTG. External right primer: CGTCGTTGGCAAAGGTAAAT. Internal left primer: GTTGAGTGAGCAATGACGGA. Internal right primer: TGCGAAATTTACGCCATACA. Internal WT amplicon: 2398 bp. Deletion size: 977 bp. Deletion left flank: CAGGAACGATTTGCAAACTTCCTGTATAAT. Deletion right flank: GAAAATATCACTAGATATTCTCTTATTCCT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037240 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037241

Source Database: WormBase (WB)
Affected Genes: WBGene00010177(F57A8.1)
Genomic Alteration: WBGene00010177(F57A8.1)
Availability: available
Source References: EMPTY
Synonyms: F57A8.1(gk1088) V.
Alternate IDs: WB-STRAIN:VC2303, CGC_VC2303
Notes: F57A8.1. External left primer: GCAAGTCGAAGAAACTTCCG. External right primer: CAAAATGTCCATCATTCCCC. Internal left primer: TCCGTGCGAAATTATGTTCA. Internal right primer: AACCTTTCCGTTTCATCACG. Internal WT amplicon: 2669 bp. Deletion size: 1244 bp. Deletion left flank: AAAATCGCAGAAACATAACGGGTAGAACAA. Deletion right flank: GATAGTGGGGTCGTGGTGGTGTGGGGGAGG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037241 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037208

Source Database: WormBase (WB)
Affected Genes: WBGene00010351(cbd-1)
Genomic Alteration: WBGene00010351(cbd-1)
Availability: available
Source References: PMID:38816072
Synonyms: cbd-1(ok2913) IV.
Alternate IDs: WB-STRAIN:VC2258, CGC_VC2258
Notes: H02I12.1. External left primer: AAACCAGTAGCCCTCCGTTT. External right primer: TGGATCTTTCCCATTCTTGC. Internal left primer: TGCAGCGATGATTCTGTCTT. Internal right primer: GTCGAGGGATGAAGAATGGA. Internal WT amplicon: 1127 bp. Deletion size: 646 bp. Deletion left flank: ACTACGCCGACGGTTGCAATGACGTATTCT. Deletion right flank: CGTATCTTGAGAATCCATTCTTCATCCCTC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037208 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037209

Source Database: WormBase (WB)
Affected Genes: WBGene00021885(Y54G2A.20)
Genomic Alteration: WBGene00021885(Y54G2A.20)
Availability: available
Source References: EMPTY
Synonyms: Y54G2A.20(gk1017) IV.
Alternate IDs: WB-STRAIN:VC2260, CGC_VC2260
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48G2A.20. External left primer: TCGCAATGAGTGTTCTCCTG. External right primer: CTCATTCCCTGAACTCTCGC. Internal left primer: GGACAGGCCGCATACATATT. Internal right primer: ATCTCAAGAACGTTCACCGC. Internal WT amplicon: 2280 bp. Deletion size: 415 bp. Deletion left flank: TGTCATCCAATAAAACCATTTTGTGAGAGT. Deletion right flank: GGAAATTTCCATCTTCTGATTAGAGGTCAA."

Proper citation: RRID:WB-STRAIN:WBStrain00037209 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037202

Source Database: WormBase (WB)
Affected Genes: WBGene00022577(nstp-3)
Genomic Alteration: WBGene00022577(nstp-3)
Availability: available
Source References: EMPTY
Synonyms: nstp-3(ok2873) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2250, CGC_VC2250
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZC250.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2873 homozygotes (late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTATCCCAAATTCCCTT. External right primer: CGTTTCATTGGGATACCTGG. Internal left primer: TTTTTGCAAATTTCCATCCG. Internal right primer: AATCTTGGCATCCACCTCAC. Internal WT amplicon: 1225 bp. Deletion size: 429 bp. Deletion left flank: TTAATAGGAAGCTGAGAATGTCAATTTTTG. Deletion right flank: AACTGATGAAAAATGGAAGAATTTAGGAAA."

Proper citation: RRID:WB-STRAIN:WBStrain00037202 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037288

Source Database: WormBase (WB)
Affected Genes: WBGene00006759(unc-22)
Genomic Alteration: WBGene00006759(unc-22)
Availability: available
Source References: EMPTY
Synonyms: unc-22(gk1237gk1238) IV.
Alternate IDs: WB-STRAIN:VC2366, CGC_VC2366
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Unc-22 twitcher. The gk1237 lesion is a point mutation (C to A) with flanks TTCCATATGGATTGGACACCTCGACTGTGT and CTCTCCAGCATCAATGTCCCAAACTTCCTT. The gk1238 lesion is a 122-bp deletion with flanks CTCCATCACTTGCTTCGAATCTATATCTGC and ACGATTTGTGGGCGACTTCCACCGGATTCC, and a single inserted base (C) at the break. Primers to amplify the region are: cggatgcttggaacaaagtt and tgctcgtgtcactggacttc. This strain was isolated after UV/TMP mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk1237gk1238), it is homozygous for 90 other mutations determined from sequence data. All mutations are annotated in WormBase."

Proper citation: RRID:WB-STRAIN:WBStrain00037288 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037289

Source Database: WormBase (WB)
Affected Genes: WBGene00003714(nhr-124)
Genomic Alteration: WBGene00003714(nhr-124)
Availability: available
Source References: EMPTY
Synonyms: nhr-124(gk1074) V.
Alternate IDs: WB-STRAIN:VC2370, CGC_VC2370
Notes: C17E7.8. External left primer: GAGTTGTTCATGAGCGCAAA. External right primer: TGTTTAAAAGTTGACCCGCC. Internal left primer: TAAGTCGCATTCACGGTTTG. Internal right primer: AGTCACGTCCGTCCAACTTC. Internal WT amplicon: 1629 bp. Deletion size: 895 bp. Deletion left flank: TTTTTAATTAACAAAAAAACATAATAAAAC. Deletion right flank: TGGAGAATAAGAATGTTCTTTCCGGACAAG.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037289 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037206

Source Database: WormBase (WB)
Affected Genes: WBGene00000229(atp-2)|WBGene00000254(bli-4)
Genomic Alteration: WBGene00000229(atp-2), WBGene00000254(bli-4)
Availability: available
Source References: EMPTY
Synonyms: atp-2(ok3002) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2255, CGC_VC2255
Notes: C34E10.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3002 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGCCACCAAGGTTTGTAT. External right primer: CGGTAAGCTTGTCTTCCTCG. Internal left primer: AGGTCTCTGCCAAGGCTACA. Internal right primer: TTTGAACTCCACGAGCAATG. Internal WT amplicon: 1178 bp. Deletion size: 500 bp. Deletion left flank: CAAGGCTACAGCTGCTAACGCTTCCGGACG. Deletion right flank: GTTACTCTGTGTTCGCTGGAGTCGGAGAGC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037206 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037204

Source Database: WormBase (WB)
Affected Genes: WBGene00004971(spe-17)
Genomic Alteration: WBGene00004971(spe-17)
Availability: available
Source References: EMPTY
Synonyms: spe-17(ok2631) IV.
Alternate IDs: WB-STRAIN:VC2253, CGC_VC2253
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK617.3. External left primer: TGCTGCACCTAACAATCAGC. External right primer: CAAGCGAACAGCAGTCACAT. Internal left primer: GCTTGAATTTTTGACTGTGGC. Internal right primer: GTTGTCGAATTATTGCGGCT. Internal WT amplicon: 1167 bp. Deletion size: 557 bp. Deletion left flank: TTAGCTGAAGTATTGGAAAAATCTCAGAAA. Deletion right flank: TGGTTAGTATTCTGGATGTTTGAGTGAGTA. Insertion Sequence: AAAAAAATCAAAAAAATCTCAAAAAAAAAAAA."

Proper citation: RRID:WB-STRAIN:WBStrain00037204 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037205

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00022599(daf-41)
Genomic Alteration: WBGene00000254(bli-4), WBGene00022599(daf-41)
Availability: available
Source References: EMPTY
Synonyms: ZC395.10(ok2968) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2254, CGC_VC2254
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZC395.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2968 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTGCCCATGGAAACTGATT. External right primer: CAATGCCATTCGCACTTAAA. Internal left primer: GAAAAACGAATGCGGGATAA. Internal right primer: TCTTGCTTGTTATTGCCGTG. Internal WT amplicon: 1196 bp. Deletion size: 501 bp. Deletion left flank: ATCCGTTCGCCATTCCACCGCCAATTCCGG. Deletion right flank: TAATTCGAAAAGAGAACTAGACGGATACGA."

Proper citation: RRID:WB-STRAIN:WBStrain00037205 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037292

Source Database: WormBase (WB)
Affected Genes: WBGene00017989(nol-10)
Genomic Alteration: WBGene00017989(nol-10)
Availability: available
Source References: EMPTY
Synonyms: nol-10(ok2965) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2374, CGC_VC2374
Notes: F32E10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2965 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGAGACATGGCACTTTCAGA. External right primer: TCCAAATCCGAAGCCATATC. Internal left primer: GGATGTTGGCTGACTCCATT. Internal right primer: CAGAGTCGGATGCATCATTG. Internal WT amplicon: 1188 bp. Deletion size: 334 bp. Deletion left flank: TGTCGTTGCTTCTATGGATTCTAGAATGAT. Deletion right flank: CTATACAACAAAGCTCAAACACAAATGCAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037292 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037210

Source Database: WormBase (WB)
Affected Genes: WBGene00010742(clc-6)
Genomic Alteration: WBGene00010742(clc-6)
Availability: available
Source References: EMPTY
Synonyms: K10D6.2(ok2876) V.
Alternate IDs: WB-STRAIN:VC2261, CGC_VC2261
Notes: K10D6.2. External left primer: TTGGAAGTGGGAAGGATGAG. External right primer: CCGAACTCGTCATCCAAAAT. Internal left primer: GCAATGGCTCCTCTCTTCTG. Internal right primer: CAACAACATTGACGAAGATGG. Internal WT amplicon: 1196 bp. Deletion size: 824 bp. Deletion left flank: CTGACGACGATCTTCGTATCTTCTGAAAAC. Deletion right flank: GTGATGTTCTGATTCTCCAGCAGCTCCATC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037210 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037298

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00014151(vps-15)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00014151(vps-15)
Availability: available
Source References: EMPTY
Synonyms: ZK930.1(ok3132)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC2382, CGC_VC2382
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK930.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3132 homozygotes (larval arrest). This strain exhibits a high level of sterility or near-sterility in heterozygotes and mIn1 homozygotes, but populations can be maintained. Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GATAGGTGGATGGCTGGAAA. External right primer: CGAAATGTTGGCTCATCTCA. Internal left primer: TCTCCTTGGCTTCTGTGTCC. Internal right primer: GCTCACTTGGCTCTTCGTCT. Internal WT amplicon: 1200 bp. Deletion size: 789 bp. Deletion left flank: TGTCCAACACGGTGCGTTCATAAATTACAA. Deletion right flank: TTGTCCAACATCAGCCCATCGGACGAAACC."

Proper citation: RRID:WB-STRAIN:WBStrain00037298 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037296

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00019629(cid-1)|WBGene00019630(emb-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00019629(cid-1), WBGene00019630(emb-1)
Availability: available
Source References: EMPTY
Synonyms: K10D2.4&cid-1(ok2756) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2380, CGC_VC2380
Notes: K10D2.4, K10D2.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2756 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 547 bp. Deletion left flank: TCACTTGCAAGACAGTGTGGCTATTCTGAC. Deletion right flank: AGAAACGCCACTTTTATTTATTTATCAACT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037296 Copy   

•   Source: Integrated Animals