Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00037200
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: F28H6(gk959) X.
Alternate IDs: WB-STRAIN:VC2247, CGC_VC2247
Notes: F28H6. External left primer: TAAATGATTGCGCCATTTCA. External right primer: TAAAAATCACCTTCCGCCAG. Internal left primer: TTCCACATCACGCAGCTTAC. Internal right primer: TTCCCTCGAATTCACATTCC. Internal WT amplicon: 2143 bp. Deletion size: 748 bp. Deletion left flank: GAACAAAATTGTAGAAAACCCAACTTGGTA. Deletion right flank: ACTCTTTTTACATTAAGTCCCACATTTCCT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037200 Copy
http://www.wormbase.org/db/get?name=WBStrain00037168
Source Database: WormBase (WB)
Affected Genes: WBGene00022106(lgc-46)
Genomic Alteration: WBGene00022106(lgc-46)
Availability: available
Source References: EMPTY
Synonyms: lgc-46(ok2949) III.
Alternate IDs: WB-STRAIN:VC2209, CGC_VC2209
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y71D11A.5. External left primer: CCAGTTTCAGCTGTGTCGAA. External right primer: GTTTTGCACGTACTTCCACG. Internal left primer: AAACTAGGCTTGTTGGGGGT. Internal right primer: CGAAGCTAATAATGGTGCCAA. Internal WT amplicon: 1314 bp. Deletion size: 492 bp. Deletion left flank: TCCCGGGAGAGGTAGCCGACCCAGGCGAGT. Deletion right flank: AACTCCCACGAATTTCTAGATAAACTCACT. Insertion Sequence: CCCACGAATTTCTAGATA."
Proper citation: RRID:WB-STRAIN:WBStrain00037168 Copy
http://www.wormbase.org/db/get?name=WBStrain00037172
Source Database: WormBase (WB)
Affected Genes: WBGene00016918(test-1)
Genomic Alteration: WBGene00016918(test-1)
Availability: available
Source References: EMPTY
Synonyms: C54E4.2(gk1003) IV.
Alternate IDs: WB-STRAIN:VC2213, CGC_VC2213
Notes: C54E4.2. External left primer: TTTTTGACGACCAACCAACA. External right primer: CGAGGCTCTTTACGCAATTC. Internal left primer: CGCAGCGAACAAAGTTATGA. Internal right primer: CGTGGCGAGACCTATAAAGC. Internal WT amplicon: 1288 bp. Deletion size: 469 bp. Deletion left flank: TTTTTTTTTTTGGAGCTTCAGTTGAAGTTG. Deletion right flank: AGTCTCAGGAATGCAATTATAATTAGATAT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037172 Copy
http://www.wormbase.org/db/get?name=WBStrain00037170
Source Database: WormBase (WB)
Affected Genes: WBGene00004170(pqn-90)
Genomic Alteration: WBGene00004170(pqn-90)
Availability: available
Source References: EMPTY
Synonyms: pqn-90(gk989) IV.
Alternate IDs: WB-STRAIN:VC2211, CGC_VC2211
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y73F8A.8. External left primer: ACAACCCGTGCAAGAAAAAC. External right primer: AAGTGGGACGGAACTGTTTG. Internal left primer: ACAATCGCGTCAGTAGGAGC. Internal right primer: CAGGGTTGTAGGACGTTGGT. Internal WT amplicon: 1894 bp. Deletion size: 519 bp. Deletion left flank: AAGCTGGTGCAGATGGAAGTGTGCATTGTG. Deletion right flank: AAGATTGACACTCATTCATAGATGGAGCAA. Insertion Sequence: ATTGACACTCATTC."
Proper citation: RRID:WB-STRAIN:WBStrain00037170 Copy
http://www.wormbase.org/db/get?name=WBStrain00037176
Source Database: WormBase (WB)
Affected Genes: WBGene00001063(dpy-1)|WBGene00019212(zmp-2)
Genomic Alteration: WBGene00001063(dpy-1), WBGene00019212(zmp-2)
Availability: available
Source References: EMPTY
Synonyms: H19M22.3(ok2827)/sC1 [dpy-1(s2170)] III.
Alternate IDs: WB-STRAIN:VC2218, CGC_VC2218
Notes: H19M22.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2827 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCCGTGACGCTTAAATGG. External right primer: ATAATTCAGTGCCCGAGAGC. Internal left primer: ATCTCCGACTACACCAGCGA. Internal right primer: AGCGTCCGTTGACTTGAGTT. Internal WT amplicon: 1135 bp. Deletion size: 538 bp. Deletion left flank: AGAAAAAAATCTAGCAGATTGCAAAATCTA. Deletion right flank: AGTGTGCAGTGAGCAGCTGCTGCGACAAGG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037176 Copy
http://www.wormbase.org/db/get?name=WBStrain00037175
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00019630(emb-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00019630(emb-1)
Availability: available
Source References: EMPTY
Synonyms: K10D2.4(ok2759) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2216, CGC_VC2216
Notes: K10D2.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2759 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 658 bp. Deletion left flank: TTAAAATCTCAGCGGGAGTTTGATCAAATT. Deletion right flank: CATTGGGAAAGACGAACCGAATAATAGGTA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037175 Copy
http://www.wormbase.org/db/get?name=WBStrain00037184
Source Database: WormBase (WB)
Affected Genes: WBGene00003056(lon-2)|WBGene00006826(unc-97)
Genomic Alteration: WBGene00003056(lon-2), WBGene00006826(unc-97)
Availability: available
Source References: EMPTY
Synonyms: +/szT1 [lon-2(e678)] I; unc-97(ok2760)/szT1 X.
Alternate IDs: WB-STRAIN:VC2228, CGC_VC2228
Notes: F14D12.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2760 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGGCCAACTTTCAGTGGTT. External right primer: TGCGCTTTTTCAATTCTGTG. Internal left primer: CGACCACAACCATATCAACG. Internal right primer: CGTTTGCATGTTGGTTTCAT. Internal WT amplicon: 1239 bp. Deletion size: 516 bp. Deletion left flank: GGATGTTTCTGTTGTGAGATTTGCAATAAA. Deletion right flank: AACAGCACTTCCACAAGGTACTTGAAATAT. Insertion Sequence: AAGATTTGCAAAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037184 Copy
http://www.wormbase.org/db/get?name=WBStrain00037181
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00006508(tns-1)|WBGene00006726(ubl-5)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006508(tns-1), WBGene00006726(ubl-5)
Availability: available
Source References: EMPTY
Synonyms: F46F11.11&ubl-5(ok2820) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2224, CGC_VC2224
Notes: F46F11.4, F46F11.11. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2820 homozygotes (viable but sickly). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAATCGGGACAGCTTCAGA. External right primer: CGCAAGTGTGAAACGCTATG. Internal left primer: AGCCATGATTTACAGGGTTCA. Internal right primer: TGCAGATTTTACCATACTTGCG. Internal WT amplicon: 3053 bp. Deletion size: 2291 bp. Deletion left flank: GTTACTGTACTTCTTTAAGGCGCACGCAAT. Deletion right flank: TCGACGCGCAAATGCAGACTTGCAATGTAA. Insertion Sequence: ACAATTGGAGATTTGAAATGTACGTAAAAACACACAAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037181 Copy
http://www.wormbase.org/db/get?name=WBStrain00037187
Source Database: WormBase (WB)
Affected Genes: WBGene00001944(his-70)
Genomic Alteration: WBGene00001944(his-70)
Availability: available
Source References: EMPTY
Synonyms: his-70(ok2906) III.
Alternate IDs: WB-STRAIN:VC2232, CGC_VC2232
Notes: E03A3.4. External left primer: TCCGTAAACTTTAGGCCACG. External right primer: TGTTCATTGAAATCACCGGA. Internal left primer: CCATCCACTGCAGACACAGT. Internal right primer: ACGTTTTTGAACGAAATGGG. Internal WT amplicon: 1317 bp. Deletion size: 370 bp. Deletion left flank: AAGAAACACGGGCATTGATCAAGATTTTAT. Deletion right flank: CGGGGAAAACCTTACGAGCAGCCTTCGTCG. Insertion Sequence: GATTT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037187 Copy
http://www.wormbase.org/db/get?name=WBStrain00037188
Source Database: WormBase (WB)
Affected Genes: WBGene00012629(slc-36.3)
Genomic Alteration: WBGene00012629(slc-36.3)
Availability: available
Source References: EMPTY
Synonyms: Y38H6C.17(ok2930) V.
Alternate IDs: WB-STRAIN:VC2233, CGC_VC2233
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y38H6C.17. External left primer: CCGGTTGCTTACATGCCTAC. External right primer: GATTCGCCAATCTTCCAAAA. Internal left primer: AAGCAATACGTACCGGTCTACA. Internal right primer: AAAGTTTCCAAATTTTTCGGC. Internal WT amplicon: 1372 bp. Deletion size: 549 bp. Deletion left flank: ATTTATGACGTCATCAATACTGGAATATAA. Deletion right flank: ACAATTTTCCAGCAAAAACTTACACTGAAT."
Proper citation: RRID:WB-STRAIN:WBStrain00037188 Copy
http://www.wormbase.org/db/get?name=WBStrain00037185
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00009004(pfd-6)
Genomic Alteration: WBGene00000254(bli-4), WBGene00009004(pfd-6)
Availability: available
Source References: EMPTY
Synonyms: pfd-6(ok2785) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2229, CGC_VC2229
Notes: F21C3.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2785 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAATTTGTGGTTGGGGATT. External right primer: ATTTCAACGCTGCTGGAGAC. Internal left primer: ATGATGGCTGACTTTGAGCA. Internal right primer: TGCAAAGTTGGTTTTCACGA. Internal WT amplicon: 1193 bp. Deletion size: 286 bp. Deletion left flank: GATGTAATTAGCAATGACTTTTAACATAGA. Deletion right flank: TGTCTGAGATGCTGGCTTCCACTCGTTTGC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037185 Copy
http://www.wormbase.org/db/get?name=WBStrain00037149
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00018303(F41G3.10)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00018303(F41G3.10)
Availability: available
Source References: EMPTY
Synonyms: F41G3.10(ok2840)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC2186, CGC_VC2186
Notes: F41G3.10. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2840 homozygotes (sickly Unc with small broods, often Dpy, various morphological defects; population can be maintained with difficulty). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGATCATTCGAGTGGGAAGA. External right primer: GTCCACTAAACTTTGCCCCA. Internal left primer: AAATTGAGGATGGATGACGC. Internal right primer: AAACTCCCACGAAATCATGC. Internal WT amplicon: 1146 bp. Deletion size: 795 bp. Deletion left flank: TGTTGCAATAAGAACGCATAGCTGTACAAT. Deletion right flank: GTGTCTAACTGTGAACGAGTGGGCTTTTAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037149 Copy
http://www.wormbase.org/db/get?name=WBStrain00037150
Source Database: WormBase (WB)
Affected Genes: WBGene00007784(ruvb-1)
Genomic Alteration: WBGene00007784(ruvb-1)
Availability: available
Source References: EMPTY
Synonyms: ruvb-1(ok2847) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2187, CGC_VC2187
Notes: C27H6.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2847 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTCCACGTCCTCTACCTGA. External right primer: GTCAAGGGACTCGGAATTGA. Internal left primer: TCTTCCACACGTTTGAGCAC. Internal right primer: CTACAGGCTGCTGGATTCGT. Internal WT amplicon: 1221 bp. Deletion size: 780 bp. Deletion left flank: CTCGAGCGCGCGATAGAGATAGGTAAAACA. Deletion right flank: AGCAATCAATACAGCTCGTCCGGCCATACA. Insertion Sequence: ATCAATACAATCAATACAATCAATACATCAATACAATTAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037150 Copy
http://www.wormbase.org/db/get?name=WBStrain00037151
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00019629(cid-1)|WBGene00019630(emb-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00019629(cid-1), WBGene00019630(emb-1)
Availability: available
Source References: EMPTY
Synonyms: K10D2.4&cid-1(ok2757) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2189, CGC_VC2189
Notes: K10D2.4, K10D2.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2757 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 713 bp. Deletion left flank: AGGCTGAAACAACCTTCATTTTACTTTTGC. Deletion right flank: AATGAAGTATATTAGGCCCTTCGTATTGCT. Insertion Sequence: AAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037151 Copy
http://www.wormbase.org/db/get?name=WBStrain00037154
Source Database: WormBase (WB)
Affected Genes: WBGene00019125(ddl-1)
Genomic Alteration: WBGene00019125(ddl-1)
Availability: available
Source References: EMPTY
Synonyms: ddl-1(ok2916) II.
Alternate IDs: WB-STRAIN:VC2193, CGC_VC2193
Notes: F59E12.10. External left primer: TCACAAGTTCTGCTTGTGGC. External right primer: GCTCACTTCAAAGTACGCCC. Internal left primer: TTCATTTTGTCTGAAAGGGAAA. Internal right primer: TGAGCCGATTGAAGAAATCC. Internal WT amplicon: 1198 bp. Deletion size: 465 bp. Deletion left flank: TTTGAAATATTTACTATAAGCCGGGTCGTC. Deletion right flank: TGGAAATATGAAAAAGGCACAAACCATATA. Insertion Sequence: TTTGATAAGAACCGTCGTAGTATGTTCTTCTGGTTTCTCTTCCACTGTTTCCTCCACGA TTTGTGAAGAGCTGGGATTCGATTCGTGAATTTCGTCTATTTCTGGTGTTGATGATGGT GTGGCGGTGGTTGATTTATCCTCCAAACCCAAACGTTGATTTATCCTCCAAAC.|"F59E12.10. External left primer: TCACAAGTTCTGCTTGTGGC. External right primer: GCTCACTTCAAAGTACGCCC. Internal left primer: TTCATTTTGTCTGAAAGGGAAA. Internal right primer: TGAGCCGATTGAAGAAATCC. Internal WT amplicon: 1198 bp. Deletion size: 465 bp. Deletion left flank: TTTGAAATATTTACTATAAGCCGGGTCGTC. Deletion right flank: TGGAAATATGAAAAAGGCACAAACCATATA. Insertion Sequence: TTTGATAAGAACCGTCGTAGTATGTTCTTCTGGTTTCTCTTCCACTGTTTCCTCCACGATTTGTGAAGAGCTGGGATTCGATTCGTGAATTTCGTCTATTTCTGGTGTTGATGATGGTGTGGCGGTGGTTGATTTATCCTCCAAACCCAAACGTTGATTTATCCTCCAAAC."|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037154 Copy
http://www.wormbase.org/db/get?name=WBStrain00037155
Source Database: WormBase (WB)
Affected Genes: WBGene00022139(tub-2)
Genomic Alteration: WBGene00022139(tub-2)
Availability: available
Source References: EMPTY
Synonyms: tub-2(ok2883) I.
Alternate IDs: WB-STRAIN:VC2194, CGC_VC2194
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y71G12A.3. External left primer: AGGCGACTTCTCTCCCTCTC. External right primer: TCATCATTATCGCCGATTCA. Internal left primer: GTGTGTGTGTGTGTGTGCGT. Internal right primer: TCCTTTCCACCAACGGATTA. Internal WT amplicon: 1267 bp. Deletion size: 861 bp. Deletion left flank: CAGATGACCTTACCCGTTATAACTTTAACC. Deletion right flank: TGGATAAGCTGCCGATTCCACTCAAGGAGA. Insertion Sequence: GATAAGC."
Proper citation: RRID:WB-STRAIN:WBStrain00037155 Copy
http://www.wormbase.org/db/get?name=WBStrain00037152
Source Database: WormBase (WB)
Affected Genes: WBGene00013221(Y54G11A.14)
Genomic Alteration: WBGene00013221(Y54G11A.14)
Availability: available
Source References: EMPTY
Synonyms: Y54G11A.14(ok2884) II.
Alternate IDs: WB-STRAIN:VC2191, CGC_VC2191
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y54G11A.14. External left primer: TCAGACCGGTCATGGTACAC. External right primer: GGCGCTACTCCACTTTTGAA. Internal left primer: AAAACGCGAAACTATCGAAAA. Internal right primer: AAAAACTTACGCCATCGCC. Internal WT amplicon: 1138 bp. Deletion size: 686 bp. Deletion left flank: AAATTCAGGATCTTGGCTCCTGGAACGCAA. Deletion right flank: TTCTTGTGGCGCGAGTTGGATGCGGAGGAG. Insertion Sequence: A."
Proper citation: RRID:WB-STRAIN:WBStrain00037152 Copy
http://www.wormbase.org/db/get?name=WBStrain00037158
Source Database: WormBase (WB)
Affected Genes: WBGene00004860(sma-6)
Genomic Alteration: WBGene00004860(sma-6)
Availability: available
Source References: EMPTY
Synonyms: sma-6(ok2894) II.
Alternate IDs: WB-STRAIN:VC2197, CGC_VC2197
Notes: C32D5.2. External left primer: GCGTTGATCCAAAGGACAGT. External right primer: CAACTTTACGCTGCGATTGA. Internal left primer: TCGCAAAGCTCTGTATCGTG. Internal right primer: TCGGGGTTTTTGATCAACTC. Internal WT amplicon: 1159 bp. Deletion size: 304 bp. Deletion left flank: GTGGGAAGTTGCAATCAGGGTTGAGGTATG. Deletion right flank: GAAAAACGTCCCAGCACTTAATGAATTGAG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037158 Copy
http://www.wormbase.org/db/get?name=WBStrain00037156
Source Database: WormBase (WB)
Affected Genes: WBGene00007307(spch-1)
Genomic Alteration: WBGene00007307(spch-1)
Availability: available
Source References: EMPTY
Synonyms: C04G2.8(ok2887) IV.
Alternate IDs: WB-STRAIN:VC2195, CGC_VC2195
Notes: C04G2.8. External left primer: TGTCCTGGGTAGGTTGGGTA. External right primer: ATCCCGAATCTGTCCAATCA. Internal left primer: GACCTTTTCACGAGGCAATC. Internal right primer: GGTCCTTCGACAACCATAGC. Internal WT amplicon: 1315 bp. Deletion size: 407 bp. Deletion left flank: ATTGAAAACGATTGGATAGAGAAGTCAGCG. Deletion right flank: AATAAGAGCGACTTCTGGAGCGGCTTCTGG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037156 Copy
http://www.wormbase.org/db/get?name=WBStrain00037157
Source Database: WormBase (WB)
Affected Genes: WBGene00011737(sqst-1)
Genomic Alteration: WBGene00011737(sqst-1)
Availability: available
Source References: EMPTY
Synonyms: T12G3.1(ok2892) IV.
Alternate IDs: WB-STRAIN:VC2196, CGC_VC2196
Notes: Made_by: Vancouver KO Group|"T12G3.1. External left primer: AGGAAGAGTGTGCGCCTTTA. External right primer: AATTCAGCAGAGCTGGCTTC. Internal left primer: TGTCAACGGACCAATCTTTG. Internal right primer: CTTCTTGTTCAAGACGGGCT. Internal WT amplicon: 1199 bp. Deletion size: 795 bp. Deletion left flank: ATCAGTGAGCACTGAAACTGCCAAAAAAGC. Deletion right flank: AATGACCAAATTCGAAGAGAAAATGGATAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037157 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within ASWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the ASWG Community.
Our Information
