Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00037051
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00017296(F09E10.6)
Genomic Alteration: WBGene00017296(F09E10.6)
Availability: available
References:
Synonyms: F09E10.6(ok2817) X.
Alternate IDs: WB-STRAIN:VC2048, CGC_VC2048
Notes: F09E10.6. External left primer: GCCACCTGCCGAGTTATTTA. External right primer: CAATTTCCTGCCATTCCTGT. Internal left primer: CGCCATGAGGTGTTTACTGA. Internal right primer: GCTACTCCCCCACCAAAAGT. Internal WT amplicon: 1115 bp. Deletion size: 635 bp. Deletion left flank: GCAGAACCCGATAGATGTCGGGCCATAGTA. Deletion right flank: AGTTTTCAGGGCCTGTTGCCTGCCTACTTC. Insertion Sequence: ACAA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037051 Copy
http://www.wormbase.org/db/get?name=WBStrain00037052
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00012974(Y48A6C.1)
Genomic Alteration: WBGene00012974(Y48A6C.1)
Availability: available
References:
Synonyms: Y48A6C.1(gk955) III.
Alternate IDs: WB-STRAIN:VC2049, CGC_VC2049
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48A6C.1. External left primer: GGGTTTTCAGCCATTTTTCA. External right primer: AATTTCAATCAGAAACGCGG. Internal left primer: TTGTATCGATTAATCCCGGC. Internal right primer: TTTCGTCCGAACCGTTAGTC. Internal WT amplicon: 2443 bp. Deletion size: 1549 bp. Deletion left flank: CCATTTTTCAGCAAAAATGCACTGACTCTG. Deletion right flank: CGTAAATTTTTTCGGGTTTTTAAACTCCAA."
Proper citation: RRID:WB-STRAIN:WBStrain00037052 Copy
http://www.wormbase.org/db/get?name=WBStrain00037050
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00017296(F09E10.6)
Genomic Alteration: WBGene00017296(F09E10.6)
Availability: available
References:
Synonyms: F09E10.6(ok2816) X.
Alternate IDs: WB-STRAIN:VC2047, CGC_VC2047
Notes: F09E10.6. External left primer: GCCACCTGCCGAGTTATTTA. External right primer: CAATTTCCTGCCATTCCTGT. Internal left primer: CGCCATGAGGTGTTTACTGA. Internal right primer: GCTACTCCCCCACCAAAAGT. Internal WT amplicon: 1115 bp. Deletion size: 398 bp. Deletion left flank: GAGGTTATTGAAAAAAAAATAAAGCAACAA. Deletion right flank: GCTTGGTGTTAACACCACATAGTGCGAAAG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037050 Copy
http://www.wormbase.org/db/get?name=WBStrain00037055
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00013796(Y116A8C.19)
Genomic Alteration: WBGene00013796(Y116A8C.19)
Availability: available
References:
Synonyms: Y116A8C.19(gk958) IV.
Alternate IDs: WB-STRAIN:VC2052, CGC_VC2052
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y116A8C.19. External left primer: GAAAAGCTCAATTTTTGCCG. External right primer: TCGCCTTCTTTTTACAGCGT. Internal left primer: CGACGTGCTATCGAACTTGA. Internal right primer: CTCCGGAATCTAGCAACCAA. Internal WT amplicon: 957 bp. Deletion size: 210 bp. Deletion left flank: CAAAGAACTGTTTTATAGTTACGATGAGTT. Deletion right flank: GAAAACTGATCTCCGTCATAAGATCCTGGA."
Proper citation: RRID:WB-STRAIN:WBStrain00037055 Copy
http://www.wormbase.org/db/get?name=WBStrain00037056
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00020094(wip-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00020094(wip-1)
Availability: available
References:
Synonyms: wip-1(ok2435) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2053, CGC_VC2053
Notes: R144.4. Homozygous sterile or near-sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2435 homozygotes (grotty, Unc, with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGTATTCCGAAGTGCGAC. External right primer: CCATGAAGAAACCCAGGAAA. Internal left primer: TCAGAAAGATTGTTCCGGTTTT. Internal right primer: GGGGGATTGACGGACTATTT. Internal WT amplicon: 3053 bp. Deletion size: 1544 bp. Deletion left flank: AAATAAGACGGTAAAGAATTTTATCAGAAT. Deletion right flank: TCAGTTCCAAGCTCAAAACCGACTCCACCT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037056 Copy
http://www.wormbase.org/db/get?name=WBStrain00037053
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00011626(T08G5.7)
Genomic Alteration: WBGene00011626(T08G5.7)
Availability: available
References:
Synonyms: T08G5.7(gk956) V.
Alternate IDs: WB-STRAIN:VC2050, CGC_VC2050
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T08G5.7. External left primer: CATCGCCTCAATCAGTCAAA. External right primer: TGTTGCCCCCTAATTTGTTG. Internal left primer: TTTCTTGCCTCCCTCTTGAA. Internal right primer: CAGTTTCCGTTTCGAAGCTC. Internal WT amplicon: 1279 bp. Deletion size: 581 bp. Deletion left flank: CAATCGTGTCACCTTATCATTCACATTTCT. Deletion right flank: GGCTGAAGTTGATCAATTCCGAATTCAGAG."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037053 Copy
http://www.wormbase.org/db/get?name=WBStrain00037054
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00018539(nhr-185)
Genomic Alteration: WBGene00018539(nhr-185)
Availability: available
References:
Synonyms: nhr-185(gk957) V.
Alternate IDs: WB-STRAIN:VC2051, CGC_VC2051
Notes: F47C10.1. External left primer: TCATTCTGGCAGGAAATTCA. External right primer: GGCGTAACGAAGTCCGATAA. Internal left primer: TCCGGTTAGTCCTGCAATTC. Internal right primer: CTGCTACCCATGTCGAGTGA. Internal WT amplicon: 2231 bp. Deletion size: 847 bp. Deletion left flank: AGCTGAGCCCGGTAGATGTCGGACCACTAA. Deletion right flank: GAGGTATAAATAAAAGTCTATAAGAAAGAC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037054 Copy
http://www.wormbase.org/db/get?name=WBStrain00037059
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00016620(dhhc-9)
Genomic Alteration: WBGene00016620(dhhc-9)
Availability: available
References:
Synonyms: C43H6.7(gk985) X.
Alternate IDs: WB-STRAIN:VC2067, CGC_VC2067
Notes: C43H6.7. External left primer: ATCTTCATATTTGACCGGCG. External right primer: TCCATTCTGCTTCGTCACTG. Internal left primer: ACCATCACCAGAAGAATGCC. Internal right primer: GGTCAAAGCTGCGAACTCAT. Internal WT amplicon: 2524 bp. Deletion size: 438 bp. Deletion left flank: GCTTTGTAGTAATGATATTGGATGTTGAAT. Deletion right flank: TTTTCGTAATTACTACAGTGTTCTCAAAAT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037059 Copy
http://www.wormbase.org/db/get?name=WBStrain00037058
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00012473(Y17G7B.22)
Genomic Alteration: WBGene00012473(Y17G7B.22)
Availability: available
References:
Synonyms: Y17G7B.22(gk1012) II.
Alternate IDs: WB-STRAIN:VC2063, CGC_VC2063
Notes: Made_by: Vancouver KO Group|"Mutagen: Formaldehyde"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y17G7B.22. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1795 bp. Deletion left flank: AAAGACGAAATTGAGAAGAAAATTGCTGAG. Deletion right flank: TTTTGGTGCTTCAAAAAACATCAAAAAATA. Insertion Sequence: AAAATTTGATACTTTTTGATGTT."
Proper citation: RRID:WB-STRAIN:WBStrain00037058 Copy
http://www.wormbase.org/db/get?name=WBStrain00037062
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00009553(hinf-1)
Genomic Alteration: WBGene00009553(hinf-1)
Availability: available
References:
Synonyms: F39B2.1(gk3174) I.
Alternate IDs: WB-STRAIN:VC2071, CGC_VC2071
Notes: Made_by: Vancouver KO Group|"This strain is homozygous for a deletion (gk3174) in F39B2.1, detectable by PCR using the following primers. External left primer: CCGGTAGTAGCTTTCCCCTC. External right primer: AAGTCGCATAAGTCCATCGG. Internal left primer: ATATCAACCATCCAGCCAGC. Internal right primer: CGTCAGAATGGTACACAGCG. Internal WT amplicon: 2358 bp. Deletion size: approximately 450 bp. Validation: gk3174 passed by CGH. Left deleted probe: CATGGTCGCGACGAGGCTCAATCTGATCCATCACGCCAACTTTTGTTTAA. Right deleted probe: GATAGAATTCAACAGAATTTTTCGAGTGAGTAAGGATTTCTGGACAGTGA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037062 Copy
http://www.wormbase.org/db/get?name=WBStrain00037063
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001707(grh-1)
Genomic Alteration: WBGene00001707(grh-1)
Availability: available
References:
Synonyms: grh-1(gk960) I.
Alternate IDs: WB-STRAIN:VC2072, CGC_VC2072
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48G8AR.1. External left primer: GTTTTCCTAAAGTTCGGCCC. External right primer: CCCTTTCACTTTTCACCGAA. Internal left primer: CATAAGCTCGATCCCAAAGC. Internal right primer: CTTTGAATCGCGGAATTTGT. Internal WT amplicon: 3012 bp. Deletion size: 786 bp. Deletion left flank: CAATGTCGATTGGCTCGTTTTTGAATTCTA. Deletion right flank: AATAGTTAAAGTCCAATTCATTGTTTATTA."
Proper citation: RRID:WB-STRAIN:WBStrain00037063 Copy
http://www.wormbase.org/db/get?name=WBStrain00037061
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00013797(Y116A8C.20)
Genomic Alteration: WBGene00013797(Y116A8C.20)
Availability: available
References:
Synonyms: Y116A8C.20(gk913) IV.
Alternate IDs: WB-STRAIN:VC2069, CGC_VC2069
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y116A8C.20. External left primer: ACGCTGTAAAAAGAAGGCGA. External right primer: TGAGCACGTTTTTGAAATGC. Internal left primer: AGCGGCTGAAGAGAAGTTTG. Internal right primer: GACTGACGCAGTGACAGGAA. Internal WT amplicon: 1414 bp. Deletion size: 378 bp. Deletion left flank: ATGGGCGGAGCTTCCCGATCAATAATTGAC. Deletion right flank: CAATTACCCTCCATCCCTTTCACATACATC."
Proper citation: RRID:WB-STRAIN:WBStrain00037061 Copy
http://www.wormbase.org/db/get?name=WBStrain00037066
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00020827(T26A8.4)
Genomic Alteration: WBGene00020827(T26A8.4)
Availability: available
References:
Synonyms: T26A8.4(gk917) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2081, CGC_VC2081
Notes: T26A8.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk917 homozygotes (Dpyish, late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCTTTGGCTCTTCTTGGAT. External right primer: TGTTTGCGCTGAGAGAGAGA. Internal left primer: GCTGAACTAATCCAGGCTGC. Internal right primer: TCCAACGTTCAAGATTCCAA. Internal WT amplicon: 1977 bp. Deletion size: 722 bp. Deletion left flank: TAATTATTATGGAAAAGTGATTTCGATTTT. Deletion right flank: AATTATTCCCATTTATTAATGCGTCAATAA. Insertion Sequence: TTGCTTACCTCCAGGGAGG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037066 Copy
http://www.wormbase.org/db/get?name=WBStrain00037067
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00015447(srab-2)
Genomic Alteration: WBGene00015447(srab-2)
Availability: available
References:
Synonyms: srab-2(gk686) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2082, CGC_VC2082
Notes: C04F5.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk686 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGTCAGACCCGCTTTGAGAA. External right primer: CAAACATGGTGCAAGACCAG. Internal left primer: CGAAGAATGCTTGCAAATGA. Internal right primer: TCCTTCGAGCCAGCTGTATT. Internal WT amplicon: 2299 bp. Deletion size: 1150 bp. Deletion left flank: AAGAAACTCTTTTGAGTTACCTCATTTTTT. Deletion right flank: TTTCTCCACGCTACTCCGACACATTATCAC.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037067 Copy
http://www.wormbase.org/db/get?name=WBStrain00037065
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00016534(C39D10.7)
Genomic Alteration: WBGene00016534(C39D10.7)
Availability: available
References:
Synonyms: C39D10.7(ok2758) X.
Alternate IDs: WB-STRAIN:VC2074, CGC_VC2074
Notes: C39D10.7. External left primer: TTTGCATGTATCCACGGTGT. External right primer: TAAGCAGCGGAAACCATTTT. Internal left primer: GGGGCACATGAGGAAATAAG. Internal right primer: TTTCAAACAAAAATTCCCCC. Internal WT amplicon: 1179 bp. Deletion size: 691 bp. Deletion left flank: CAGATAACTTGTGATTTTGCACAGTCTAAC. Deletion right flank: TAGAGTTGTTGTGAAGATTGTTGATGTGTA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037065 Copy
http://www.wormbase.org/db/get?name=WBStrain00037024
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003151(mca-1)
Genomic Alteration: WBGene00003151(mca-1)
Availability: available
References:
Synonyms: mca-1(ok2532) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2000, CGC_VC2000
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"W09C2.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2532 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGGTTAGAAGCTGACGAGCG. External right primer: TGAATCCGATCCAGTTCTCC. Internal left primer: CAGTCGGCAGATTTCACAGA. Internal right primer: CCGGAAAAATGCTCATCACT. Internal WT amplicon: 3166 bp. Deletion size: 1418 bp. Deletion left flank: TCGCGGATTCTCTCATTGAATTCCTTTCCT. Deletion right flank: ACTTTTCCATTTTCGTCGCGGATTCTCTCA."
Proper citation: RRID:WB-STRAIN:WBStrain00037024 Copy
http://www.wormbase.org/db/get?name=WBStrain00037028
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00010704(K09A11.1)
Genomic Alteration: WBGene00010704(K09A11.1)
Availability: available
References:
Synonyms: K09A11.1(gk1064) X.
Alternate IDs: WB-STRAIN:VC2006, CGC_VC2006
Notes: K09A11.1. Identified by PCR, validated by CGH. External left primer: GAGCAACGAAATTTTGGGAA. External right primer: GTTATGTTTGCCGCGAGATT. Internal left primer: GGAGTATCCGTCCGCAATAG. Internal right primer: TGCAGCTCTCTTTCCATGTG. Internal WT amplicon: 2161 bp. Deletion size: 810 bp. Deletion left flank: TTTGTTCTCCACTCTTTATTCGTATTGAAT. Deletion right flank: GTACGAAGACCAACTAAGAATGGAATTGAA. Insertion Sequence: CTTATTTC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037028 Copy
http://www.wormbase.org/db/get?name=WBStrain00037034
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001461(flp-18)
Genomic Alteration: WBGene00001461(flp-18)
Availability: available
References:
Synonyms: flp-18(gk3063) X.
Alternate IDs: WB-STRAIN:VC2016, CGC_VC2016
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48D7A.2. External left primer: TGTGCCACTCACCGATGACAC. External right primer: CATCATCATGGCGCTACG. Internal left primer: GTCCTATCAGTACCTCATGGG. Internal right primer: CGAATACCTTGTACACGC. Internal WT amplicon: 2980 bp. Deletion size: 1312 bp. Deletion left flank: AACACACGTCAACCATGAACAAATCTGCTT. Deletion right flank: AAATTTCAAATTCATGCTTTCAAATCGACA."
Proper citation: RRID:WB-STRAIN:WBStrain00037034 Copy
http://www.wormbase.org/db/get?name=WBStrain00037031
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006829(unc-101)|WBGene00013020(ndrr-1)
Genomic Alteration: WBGene00006829(unc-101), WBGene00013020(ndrr-1)
Availability: available
References:
Synonyms: Y48G10A.3(ok2508)/hIn1 [unc-101(sy241)] I.
Alternate IDs: WB-STRAIN:VC2011, CGC_VC2011
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y48G10A.3. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGGATGGTTTTCGCAGTTT. External right primer: TGACATGCAGCCTCTAATGG. Internal left primer: ATTCTGCGTCTCCTGCATCT. Internal right primer: AAAAGTGAACACGGCCTTTG. Internal WT amplicon: 2246 bp. Deletion size: 1628 bp. Deletion left flank: AAAAGAGCATCATGCTCTCCGTCACAGCGT. Deletion right flank: TTTTAAAAAAGTTTTGGTTTTTTTTTTAAA."
Proper citation: RRID:WB-STRAIN:WBStrain00037031 Copy
http://www.wormbase.org/db/get?name=WBStrain00037032
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00012473(Y17G7B.22)|WBGene00016114(flp-27)
Genomic Alteration: WBGene00012473(Y17G7B.22), WBGene00016114(flp-27)
Availability: available
References:
Synonyms: flp-27(gk3331) Y17G7B.22(gk1062) II; gkDf45 X.
Alternate IDs: WB-STRAIN:VC2012, CGC_VC2012
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1062) in Y17G7B.22, detectable by PCR using the following primers. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1412 bp. Deletion left flank: AAATAGACTATTTCGGAAAATGGAAATGAG. Deletion right flank: AAAATTATTGATTTTGACCCCAAAAATTTA. Insertion Sequence: TTGT. Validation: gk1062 passed by diagnostic PCR and CGH. Other deletions (gk3331, gkDf45) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037032 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within ASWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the ASWG Community.
Our Information
